Allajulus nitidus

(Verhoeff, 1891) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Diplopoda/Julida/Julidae/Allajulus

At a glance

Occurrence records3 742

Data sources6

Biological traits2

DNA specimens45

eDNA detections39

Sources6 archives

Databases and archives Allajulus nitidus's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 742 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 742 records

Environmental DNA3 datasets · 6 countries39 detections

DNA & barcodingBOLD45 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)saprophagous

Feeding guild (larval)saprophagous

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allajulus nitidus has left across the world's sequence archives.

At a glance

DNA specimens45

BINs1

Marker genes1

eDNA detections39

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

24Cmostly conserved

61Gmostly conserved

166Gvariable

181Cvariable

184Tvariable

295Gvariable

364Cvariable

376Cvariable

409Tvariable

415Gvariable

550Gmostly conserved

559Tmostly conserved

634Tvariable

CACCCTCTATTTAATTTTTGGTGCTTGGGCTGCCATGGCCGGCACAGCTCTAAGTATGTTGATTCGTATAGAGTTGTCCTACCCCGGCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes6

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Julus scandinaviussame family17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 742 records

Wild obs. + sensor2 391

Museum / vouchered1 347

Cultivated / captive4

Origin

Native977

Range

Area of Occupancy AOO2 612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤100 m 196≤1 km 119≤10 km 1 502

1 817 georeferenced · 574 without coordinates

Open the mapobservation + sensor2 391

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 35≤1 km 47≤10 km 534>10 km 3

619 georeferenced · 728 without coordinates

Open the institutions mapphysical evidence1 347

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	553
Musee d'Histoire Naturallelocation not on record	400
Norman Lindnerlocation not on record	97
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	86
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	55
BioFokuslocation not on record	37
Universität Zürich, Naturhistorisches Museumlocation not on record	22
SLU Artdatabankenlocation not on record	16
Bern, CH	14
ZMB/Myrlocation not on record	14
Geneva, CH	10
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	10
Tartu, EE	6
SNSB-Zoologische Staatssammlung Münchenlocation not on record	5
Helsinki, FI	3
Paro, BT	2
Bavarian State Collection of Zoologylocation not on record	2
Natural History Museum, Londonlocation not on record	2
Copenhagen, DK	2
South Kensington, GB	2
neflocation not on record	1
MZLUlocation not on record	1

22 institutions · 1 340 of 1 347 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA39 detections

Where the DNA of Allajulus nitidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys3

Countries6

Verifiable raw sequence linked17

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map6 countries0

park area (sports area, football place)Dendrological gardenBergknauser, tÃ¸rrenger og veikanter pÃ¥ meg…Synanthropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 9.10–16.7

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.8 °C 13.1–20.4

Min temp (night)10.7 °C 4.50–13.8

Precipitation81.7 mm/mo 55.7–159

Air humidity60.7 % 58.1–64.1

Moisture balance-42.9 mm/mo -46.6–49.7

Vapour deficit663 Pa 472–751

Wind speed3.30 m/s 2.10–3.90

Cloud cover45.9 % 35.5–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allajulus nitidus

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type3 742 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 742 records