Allagrapha aerea

Hübner, 1803 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Allagrapha

At a glance

Occurrence records2 365

Data sources7

Biological traits0

DNA specimens42

eDNA detections42

Sources7 archives

Databases and archives Allagrapha aerea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 365 records

Environmental DNA1 datasets · 2 countries42 detections

DNA & barcodingBOLD42 specimens

01Narrative

Allagrapha aerea, the unspotted looper moth or copper looper moth, is a moth of the family Noctuidae. The species was first described by Jacob Hübner in 1803. It is found in eastern North America from southern Ontario to the Florida Panhandle and west to western Nebraska. The wingspan is 28–42 mm. Adults are on wing from April to September or to October in the south. There are two generations per year. The larvae are probably general feeders on herbaceous plants. Larvae have been recorded on Urtica, Aster umbellatus and soybeans.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allagrapha aerea has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections42

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

653Tmostly conserved

TACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACATCCTTAAGATTACTAATTCGAGCAGAATTAGGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysanympha formosasame family6.1%Chrysodeixis illuminatasame family6.4%Ctenoplusia triteiasame family6.5%Thysanoplusia intermixtasame family6.5%Rachiplusia virgulasame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 365 records

Wild obs. + sensor1 861

Museum / vouchered504

Range

Area of Occupancy AOO4 760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 1 005≤1 km 308≤10 km 65>10 km 151

1 529 georeferenced · 332 without coordinates

Open the mapobservation + sensor1 861

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 79≤10 km 179>10 km 26

287 georeferenced · 217 without coordinates

Open the institutions mapphysical evidence504

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	119
New Haven, US	109
Cleveland Museum of Natural History, OH (CLEV)location not on record	56
Mississippi State, US	29
St. Paul, US	28
University of Alberta Museums (UAM)location not on record	20
Georgia Museum of Natural Historylocation not on record	13
Helsinki, FI	11
King Saud Universitylocation not on record	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
CUlocation not on record	9
Cornell University Insect Collectionlocation not on record	9
Colorado State Universitylocation not on record	9
OSUClocation not on record	6
North Carolina State University Insect Museumlocation not on record	6
Decorah, US	5
SOVTlocation not on record	4
Toronto, CA	4
Biodiversity Institute of Ontariolocation not on record	2
UNHClocation not on record	1
San Diego, US	1
Washington, US	1
Tartu, EE	1
University of Guelphlocation not on record	1

24 institutions · 465 of 504 vouchered records shown · 39 without an institution code

09Environmental DNA42 detections

Where the DNA of Allagrapha aerea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map2 countries0

Temperate mixed forestRiparian Zone14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 9.90–21.6

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.7 °C 15.6–25.8

Min temp (night)13.5 °C 5.50–17.9

Precipitation94.9 mm/mo 81.3–139

Air humidity58.9 % 56.0–61.7

Moisture balance-30.4 mm/mo -61.2–17.9

Vapour deficit888 Pa 536–1,063

Wind speed3.40 m/s 2.80–4.10

Cloud cover41.3 % 28.8–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allagrapha aerea

At a glance

Sources7 archives

At a glance

Record type2 365 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 365 records