Allacma fusca

(C.Linnæus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Collembola/Symphypleona/Sminthuridae/Allacma

At a glance

Occurrence records3 460

Data sources10

Biological traits0

DNA specimens505

eDNA detections2 742

Sources10 archives

Databases and archives Allacma fusca's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 460 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 742 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics505 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 460 records

Environmental DNA5 datasets · 10 countries2 742 detections

DNA & barcodingBOLD505 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈423 Mbp

01Narrative

Allacma fusca is a species of springtail. This species is endemic to western areas of Continental Europe and the British Isles, where it lives in the surface layers of the soil in moist habitats such as among leaf litter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding505 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allacma fusca has left across the world's sequence archives.

At a glance

DNA specimens505

BINs1

Marker genes3

eDNA detections2 742

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus462 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

194Gvariable

338Cmostly conserved

485Gmostly conserved

CCCTATATCTTATTATAGGTGTTTGATCAGCAATAGTTGGGACGGCCTTTAGAGTCCTAATTCGACTTGAATTGGGACAACCGGGTAGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes14

BIN1

Most divergent pair2.7%

EuropeN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Allacma fusca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈422 918 066 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Allacma fusca0.42 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records10–122n range12median12mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 122×GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Dallai R, Fanciulli PP, Frati F (2004) New data on the aberrant spermatogenesis of Collembola. Pedobiologia 48: 487-492. ↗

2n 101×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness94.4% BUSCO

08Occurrence & distribution

Record type3 460 records

Wild obs. + sensor2 373

Museum / vouchered1 085

Other2

Range

Area of Occupancy AOO6 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 781≤1 km 726≤10 km 203>10 km 48

1 758 georeferenced · 615 without coordinates

Open the mapobservation + sensor2 373

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 585≤1 km 5≤10 km 29

619 georeferenced · 466 without coordinates

Open the institutions mapphysical evidence1 085

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	115
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	59
Fjellberglocation not on record	31
BioFokuslocation not on record	30
UMUlocation not on record	28
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	25
Norwegian Institute of Bioeconomy Researchlocation not on record	17
Department of Microbiology, Prince of Songkla Universitylocation not on record	13
SLU Artdatabankenlocation not on record	9
MPGUlocation not on record	8
Philadelphia, US	6
University of Rouen, ECODIV Laboratorylocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
University of Tokyo, Department of Zoologylocation not on record	2
MOLARTlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Wellcome Sanger Institutelocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
"Privolzhskaya lesostep" Nature Reservelocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
South Kensington, GB	1

21 institutions · 357 of 1 085 vouchered records shown · 727 without an institution code

09Environmental DNA2 742 detections

Where the DNA of Allacma fusca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 742

Studies independent surveys5

Countries10

Verifiable raw sequence linked2 235

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 742 detections have coordinates

Open the map10 countries0

Bog edge in alpine birch forestForestUrbanSea shore1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 11.2–16.9

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.2 °C 14.4–20.2

Min temp (night)11.8 °C 8.00–13.8

Precipitation81.7 mm/mo 61.0–116

Air humidity61.8 % 59.2–64.6

Moisture balance-10.4 mm/mo -58.6–48.1

Vapour deficit638 Pa 478–762

Wind speed2.90 m/s 2.40–5.00

Cloud cover48.6 % 42.8–55.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 737 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allacma fusca

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 460 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 460 records