Aliger gallus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Strombidae/Aliger

At a glance

Occurrence records235

Data sources9

Biological traits5

DNA specimens6

eDNA detections7

Sources9 archives

Databases and archives Aliger gallus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility136 records↗

OBISOcean Biodiversity Information System99 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS235 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceGoaT≈1.9 Gbp

01Narrative

Aliger gallus, previously known as Strombus gallus, common name the rooster conch or rooster-tail conch,Dance P. S. (1977). The Encyclopedia of Shells. Blandford Press, Dorset. 82-83. . is a species of medium-sized sea snail, a marine gastropod mollusk in the family Strombidae, the true conchs.MolluscaBase eds. (2020). MolluscaBase. Aliger gallus (Linnaeus, 1758). Accessed through: World Register of Marine Species at: http://www.marinespecies.org/aphia.php?p=taxdetails&id=419692 on 2020-04-02

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length19.7 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max82 m

Depth min0 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aliger gallus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

85Avariable

110Tvariable

214Avariable

220Cvariable

229Avariable

286Gvariable

406Cmostly conserved

412Gmostly conserved

517Tmostly conserved

TACGCTATACATTTTATTTGGCATGTGATCTGGCTTAGTTGGAACTGCTTTAAGTCTGCTAATTCGAGCTGAACTCGGGCAGCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes5

BIN1

Most divergent pair1.2%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aliger gigassame genus8.8%Lobatus raninussame family11.2%Dolomena labiosasame family14.0%Canarium incisumsame family14.9%Strombus labiatussame family15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Aliger gallus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 877 643 533 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aliger gallus1.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type235 records

Wild obs. + sensor55

Museum / vouchered180

Range

Area of Occupancy AOO640 km²

Depth

0–200 m sunlit43

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 41.1 m · max 100 m · 43 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 7≤1 km 4≤10 km 5>10 km 10

26 georeferenced · 29 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤1 km 19≤10 km 13>10 km 46

78 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence180

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	20
Philadelphia, US	14
Natural History Museum Rotterdamlocation not on record	11
Brussels, BE	9
Denver, US	6
RBINS-Scientific Heritagelocation not on record	6
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	3
NTNU-VMlocation not on record	3
Santa Barbara Museum of Natural Historylocation not on record	3
Paleontological Research Institutionlocation not on record	3
Chongqing Museumlocation not on record	2
Salzburg, AT	1
Helsinki, FI	1

13 institutions · 82 of 180 vouchered records shown · 9 without an institution code

09Environmental DNA7 detections

Where the DNA of Aliger gallus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)