Alienacanthomysis macropsis

(W.M.Tattersall, 1932) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Mysida/Mysidae/Alienacanthomysis

At a glance

Occurrence records485

Data sources6

Biological traits1

DNA specimens10

eDNA detections9

Sources6 archives

Databases and archives Alienacanthomysis macropsis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility244 records↗

OBISOcean Biodiversity Information System241 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS485 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Alienacanthomysis macropsis is een aasgarnalensoort uit de familie van de Mysidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1932 door W. Tattersall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alienacanthomysis macropsis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

56Cmostly conserved

67Tmostly conserved

82Gmostly conserved

133Gmostly conserved

184Gmostly conserved

193Tmostly conserved

196Gmostly conserved

208Amostly conserved

220Gmostly conserved

247Cmostly conserved

271Tmostly conserved

283Tmostly conserved

298Tvariable

301Gmostly conserved

307Gmostly conserved

316Tmostly conserved

337Tmostly conserved

340Tmostly conserved

343Amostly conserved

346Cmostly conserved

352Cmostly conserved

412Tmostly conserved

451Tmostly conserved

547Tmostly conserved

568Tmostly conserved

571Tmostly conserved

580Amostly conserved

592Amostly conserved

634Tmostly conserved

646Cmostly conserved

AACATTATATTTCATATTTGGTGCATGAGCAGGAATAGTAGGAACTTCTTTAAGTCTGTTAATTCGTTTAGAATTAAGACAGATAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes4

BINs2

Most divergent pair4.0%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type485 records

Wild obs. + sensor12

Museum / vouchered470

Other3

Range

Area of Occupancy AOO232 km²

Depth

0–200 m sunlit232

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 48.4 m · max 115.5 m · 232 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 5≤1 km 6≤10 km 4>10 km 1

16 georeferenced · 454 without coordinates

Open the institutions mapphysical evidence470

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	12
Stockholm, SE	12
Instituto de Investigaciones Oceanológicas, Universidad Autónoma de Baja Californialocation not on record	1

3 institutions · 25 of 470 vouchered records shown · 215 without an institution code

09Environmental DNA9 detections

Where the DNA of Alienacanthomysis macropsis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

Planktonicwater column

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.90 °C 4.70–8.90

Seasonal swing summer↔winter15.7 °C

Max temp (day)13.2 °C 7.20–13.2

Min temp (night)4.20 °C 1.50–4.20

Precipitation109 mm/mo 109–189

Air humidity63.2 % 63.2–68.4

Moisture balance23.7 mm/mo 23.7–143

Vapour deficit420 Pa 281–420

Wind speed3.90 m/s 3.80–3.90

Cloud cover45.6 % 45.6–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)