Aleyrodes lonicerae

Walker, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aleyrodidae/Aleyrodes

At a glance

Occurrence records465

Data sources7

Biological traits0

DNA specimens370

eDNA detections1 248

Sources7 archives

Databases and archives Aleyrodes lonicerae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility465 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 248 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics370 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF465 records

Environmental DNA4 datasets · 15 countries1 248 detections

DNA & barcodingBOLD370 specimens

01Narrative

Aleyrodes lonicerae, l'Aleurode du chèvrefeuille, est une espèce eurasiatique d'insectes hémiptères de la famille des Aleyrodidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding370 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleyrodes lonicerae has left across the world's sequence archives.

At a glance

DNA specimens370

BINs2

Marker genes1

eDNA detections1 248

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus367 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

70Amostly conserved

466Tmostly conserved

TTTATATTTTATTTTTGGGATTTGAAGTGGGCTATTAGGCACCTCTTTAAGTGTATTGATTCGTCTTGAACTTAGTAATATCGGTTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes15

BINs2

Most divergent pair13.8%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleyrodes proletellasame genus13.3%Aleyrodes shizuokensissame genus14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type465 records

Wild obs. + sensor299

Museum / vouchered166

Range

Area of Occupancy AOO1 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 78≤1 km 22≤10 km 183

283 georeferenced · 16 without coordinates

Open the mapobservation + sensor299

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 30≤1 km 4≤10 km 2

36 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	66
University of Guelph, Centre for Biodiversity Genomicslocation not on record	23
NTNU-VMlocation not on record	15
Helsinki, FI	2
Wellcome Sanger Institutelocation not on record	1
MZLUlocation not on record	1

6 institutions · 108 of 166 vouchered records shown · 58 without an institution code

09Environmental DNA1 248 detections

Where the DNA of Aleyrodes lonicerae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 248

Studies independent surveys4

Countries15

Verifiable raw sequence linked635

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 248 detections have coordinates

Open the map15 countries0

UrbanForestHay meadow1. Forest & Woodland | 1.4. Temperate Forest1. Forest & WoodlandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 6.20–18.2

Seasonal swing summer↔winter19.8 °C

Max temp (day)16.5 °C 9.00–22.6

Min temp (night)10.0 °C 2.60–14.2

Precipitation65.2 mm/mo 49.7–111

Air humidity61.5 % 56.5–65.7

Moisture balance0.1 mm/mo -52.2–48.0

Vapour deficit585 Pa 343–919

Wind speed2.70 m/s 2.10–4.70

Cloud cover48.3 % 39.8–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 1 248 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)