Aleurotrachelus atratus

Hempel, 1922 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aleyrodidae/Aleurotrachelus

At a glance

Occurrence records15

Data sources8

Biological traits0

DNA specimens10

eDNA detections20

Sources8 archives

Databases and archives Aleurotrachelus atratus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF15 records

Environmental DNA3 datasets · 3 countries20 detections

DNA & barcodingBOLD10 specimens

01Narrative

Aleurotrachelus atratus better known as the palm-infesting whitefly is an invasive species that affects coconut palms. Originally, this species was only prevalent in Brazil and was known to feed on coconuts native to this country. Now, the species has migrated to the tropics and subtropics and is invasive in many other countries. Aleurotrachelus is one of the largest genus, containing 74 species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleurotrachelus atratus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections20

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P665 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 78% of positions are identical in every specimen.

Diversity (π)4.9%

Haplotypes3

BINs2

Most divergent pair20.2%

Where individuals differ — all 143 variable positions, in barcode order

8Amostly conserved

21Amostly conserved

26Tmostly conserved

29Cmostly conserved

41Cmostly conserved

44Amostly conserved

45Amostly conserved

47Tmostly conserved

50Tmostly conserved

51Amostly conserved

53Amostly conserved

59Tmostly conserved

63Cmostly conserved

68Amostly conserved

69Amostly conserved

74Tmostly conserved

75Gmostly conserved

76Tmostly conserved

77Tmostly conserved

80Gmostly conserved

91Tmostly conserved

102Amostly conserved

107Amostly conserved

119Amostly conserved

122Cmostly conserved

128Tmostly conserved

129Tmostly conserved

131Amostly conserved

134Amostly conserved

137Cmostly conserved

140Amostly conserved

155Amostly conserved

166Tmostly conserved

167Gmostly conserved

182Amostly conserved

188Gmostly conserved

191Cmostly conserved

197Amostly conserved

212Tmostly conserved

219Gmostly conserved

224Tmostly conserved

225Tmostly conserved

227Cmostly conserved

233Cmostly conserved

242Cmostly conserved

248Gmostly conserved

251Amostly conserved

258Tmostly conserved

270Cmostly conserved

272Tmostly conserved

276Amostly conserved

285Cmostly conserved

287Tmostly conserved

289Cmostly conserved

291Amostly conserved

293Amostly conserved

296Gmostly conserved

297Amostly conserved

299Tmostly conserved

301Cmostly conserved

302Tmostly conserved

305Tmostly conserved

306Tmostly conserved

314Gmostly conserved

317Gmostly conserved

319Gmostly conserved

320Amostly conserved

324Tmostly conserved

335Tmostly conserved

338Gmostly conserved

341Amostly conserved

344Gmostly conserved

353Tmostly conserved

354Cmostly conserved

356Amostly conserved

360Amostly conserved

361Tmostly conserved

362Amostly conserved

363Amostly conserved

364Amostly conserved

365Tmostly conserved

366Amostly conserved

368Gmostly conserved

369Tmostly conserved

373Amostly conserved

377Tmostly conserved

380Tmostly conserved

382Gmostly conserved

393Amostly conserved

395Amostly conserved

397Cmostly conserved

398Amostly conserved

404Amostly conserved

422Gmostly conserved

423Gmostly conserved

424Cmostly conserved

437Amostly conserved

443Amostly conserved

444Amostly conserved

446Amostly conserved

488Tmostly conserved

491Tmostly conserved

492Cmostly conserved

497Tmostly conserved

500Amostly conserved

501Amostly conserved

503Amostly conserved

525Tmostly conserved

537Tmostly conserved

539Tmostly conserved

540Tmostly conserved

542Amostly conserved

546Tmostly conserved

549Amostly conserved

555Tmostly conserved

557Gmostly conserved

560Tmostly conserved

563Tmostly conserved

564Tmostly conserved

572Amostly conserved

+23 more variable positions not shown

ATATTGGAATACTTTATTTTATTTTTGGCATTTGAAGAGGCTTAATTGGTACATCTTTTAGTCTTATAATTCGTGTTGAGTTAAGAAATG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleurotrachelus socialissame genus15.0%Aleurothrixus trachoidessame family16.0%Aleurothrixus floccosussame family17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor14

Museum / vouchered1

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 8>10 km 6

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA20 detections

Where the DNA of Aleurotrachelus atratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys3

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 25.8–27.2

Seasonal swing summer↔winter1.60 °C

Max temp (day)30.4 °C 28.6–31.2

Min temp (night)23.4 °C 22.4–24.2

Precipitation170 mm/mo 113–202

Air humidity65.1 % 63.9–67.4

Moisture balance9.70 mm/mo -39.4–66.6

Vapour deficit1,227 Pa 1,045–1,277

Wind speed2.70 m/s 2.10–6.70

Cloud cover29.0 % 27.8–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)