Aleuron carinata

Walker, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Aleuron

At a glance

Occurrence records65

Data sources6

Biological traits0

DNA specimens27

eDNA detections23

Sources6 archives

Databases and archives Aleuron carinata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 3 countries23 detections

DNA & barcodingBOLD27 specimens

01Narrative

Aleuron carinata is a moth of the family Sphingidae. It was described by Francis Walker in 1856

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleuron carinata has left across the world's sequence archives.

At a glance

DNA specimens27

BINs2

Marker genes1

eDNA detections23

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

34Tmostly conserved

37Amostly conserved

40Tmostly conserved

59Cmostly conserved

82Cmostly conserved

106Tmostly conserved

115Cmostly conserved

127Tmostly conserved

136Cmostly conserved

220Avariable

229Amostly conserved

232Amostly conserved

283Tmostly conserved

286Tmostly conserved

304Tmostly conserved

358Tmostly conserved

379Amostly conserved

386Tmostly conserved

391Tmostly conserved

421Gmostly conserved

439Tmostly conserved

451Tmostly conserved

470Amostly conserved

482Cmostly conserved

539Cmostly conserved

544Tmostly conserved

565Amostly conserved

571Tmostly conserved

589Cmostly conserved

596Tmostly conserved

598Amostly conserved

601Tmostly conserved

613Tmostly conserved

616Tmostly conserved

628Avariable

631Amostly conserved

634Tmostly conserved

640Cvariable

646Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes6

BINs2

Most divergent pair5.6%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleuron chloropterasame genus4.4%Unzela japixsame family7.0%Enyo bathussame family7.3%Perigonia luscasame family7.4%Perigonia passerinasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor36

Museum / vouchered29

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 17≤1 km 8≤10 km 3>10 km 4

32 georeferenced · 4 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 4

5 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	4
University of Pennsylvanialocation not on record	4
National Biodiversity Institute, Costa Ricalocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
The University of the West Indies, Trinidad and Tobagolocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
FLMNH-UFlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

8 institutions · 17 of 29 vouchered records shown · 12 without an institution code

09Environmental DNA23 detections

Where the DNA of Aleuron carinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.0–25.4

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.3 °C 26.6–28.6

Min temp (night)22.1 °C 21.3–23.7

Precipitation340 mm/mo 178–415

Air humidity70.6 % 67.2–71.9

Moisture balance199 mm/mo 30.3–281

Vapour deficit916 Pa 835–1,044

Wind speed2.70 m/s 1.30–3.60

Cloud cover38.9 % 27.7–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)