Aleurolobus barodensis

(Maskell, 1896) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aleyrodidae/Aleurolobus

At a glance

Occurrence records30

Data sources7

Biological traits0

DNA specimens6

eDNA detections1

Sources7 archives

Databases and archives Aleurolobus barodensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD6 specimens

01Narrative

Aleurolobus barodensis is een halfvleugelig insect uit de familie witte vliegen (Aleyrodidae), onderfamilie Aleyrodinae. De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd door Maskell in 1896. The insect is sometimes known as sugarcanewhite fly. It is a polyphagous pest commonly found on sugarcane, jowar, bajra, barley. The damage is caused by the nymph and adult.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleurolobus barodensis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

46Tvariable

AATGTATTTTTTTTTTGGGGTTTGGAGAGGCTTAGTAGGAACTTCTTTTAGGTTGCTGATTCGTGTTGAGTTAAGCAACGCAGGTATATT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type30 records

Museum / vouchered30

Range

Area of Occupancy AOO32 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 30 records without

Open the institutions mapphysical evidence30

10Collections & institutions

Institution	Specimens
DPIlocation not on record	29

1 institutions · 29 of 30 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aleurolobus barodensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–21.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)27.1 °C

Min temp (night)14.9 °C

Precipitation12.1 mm/mo

Air humidity50.3 %

Moisture balance-77.3 mm/mo

Vapour deficit1,237 Pa

Wind speed1.30 m/s

Cloud cover10.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)