Aleurodicus rugioperculatus

Martin, 2004 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aleyrodidae/Aleurodicus

At a glance

Occurrence records86

Data sources8

Biological traits0

DNA specimens200

eDNA detections198

Sources8 archives

Databases and archives Aleurodicus rugioperculatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility86 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI198 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics200 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF86 records

Environmental DNA1 datasets · 2 countries198 detections

DNA & barcodingBOLD200 specimens

01Narrative

Aleurodicus rugioperculatus (known variously as the rugose spiraling whitefly, the gumbo limbo spiraling whitefly or just the spiraling whitefly) is a species of whitefly found throughout the Florida Keys.Gumbo Limbo Spiraling Whitefly - Monroe County Extension Office - UF/IFAS Extension: Solutions for Your Life - Institute of Food and Agricultural Sciences This insect was first described by Jon H. Martin in 2004.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding200 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleurodicus rugioperculatus has left across the world's sequence archives.

At a glance

DNA specimens200

BINs3

Marker genes2

eDNA detections198

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus194 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

76Gmostly conserved

TTTTATATTTTATTTTTGGTATTTGAAGAGGATTTATTGGTGCTTCTATAAGATTATTAATTCGAATAGAATTAAGAATATTAGGAAGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.86%

Haplotypes4

BINs3

Most divergent pair1.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleurodicus dispersussame genus10.8%Aleurodicus dugesiisame genus11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_082097 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type86 records

Wild obs. + sensor6

Museum / vouchered80

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 1>10 km 2

4 georeferenced · 2 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 80 records without

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA198 detections

Where the DNA of Aleurodicus rugioperculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found198

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 198 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.7. Subtropical/tropic…Coconut

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 19.6–27.9

Seasonal swing summer↔winter7.90 °C

Max temp (day)28.5 °C 24.9–31.2

Min temp (night)20.8 °C 14.2–25.0

Precipitation45.0 mm/mo 0.9–298

Air humidity59.5 % 52.0–66.2

Moisture balance-48.8 mm/mo -164–244

Vapour deficit1,237 Pa 1,026–1,616

Wind speed2.30 m/s 1.70–5.80

Cloud cover21.7 % 13.0–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 118 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)