Aleurocanthus woglumi

Ashby, 1915 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aleyrodidae/Aleurocanthus

At a glance

Occurrence records62

Data sources8

Biological traits0

DNA specimens8

eDNA detections9

Sources8 archives

Databases and archives Aleurocanthus woglumi's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD8 specimens

01Narrative

Aleurocanthus woglumi is a species of whitefly in the family Aleyrodidae. It is a pest of citrus crops, and is commonly known as the citrus blackfly because of its slate-blue colour. It originated in Asia, but has spread to other parts of the world.Dietz HF, Zetek J. 1920. The blackfly of citrus and other subtropical plants. USDA Bulletin 885: 1-55. The parasitic wasps, Encarsia perplexa and Amitus hesperidum can help control the pest.Browning HW, Childers CC, Stansly PA, Peña J, Rogers ME. (November 2008). 2009 Florida citrus pest management guide: soft-bodied insects attacking foliage and fruit. EDIS. ENY-604.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleurocanthus woglumi has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections9

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P551 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.56%

Haplotypes2

BIN1

Most divergent pair1.8%

Where individuals differ — all 10 variable positions, in barcode order

1Amostly conserved

38Amostly conserved

58Cmostly conserved

61Tmostly conserved

73Cmostly conserved

127Amostly conserved

325Amostly conserved

334Tmostly conserved

344Gmostly conserved

397Gmostly conserved

ATTAATAATTACTGGTTCTTTTATTATAAATGACCAGATTTATAATTCTTTAGTGACCGCTCATGCTTTTATCATGATTTTCTTTATAAC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor26

Museum / vouchered35

Cultivated / captive1

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 7≤1 km 1≤10 km 4>10 km 6

18 georeferenced · 8 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 35 records without

Open the institutions mapphysical evidence35

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DPIlocation not on record	30

1 institutions · 30 of 35 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Aleurocanthus woglumi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

Forest1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 21.1–31.0

Seasonal swing summer↔winter14.1 °C

Max temp (day)30.5 °C 26.0–37.8

Min temp (night)21.2 °C 16.3–22.4

Precipitation2.00 mm/mo 1.70–95.4

Air humidity42.3 % 41.0–63.7

Moisture balance-132 mm/mo -198–-42.9

Vapour deficit1,616 Pa 984–2,618

Wind speed2.60 m/s 1.60–3.70

Cloud cover18.9 % 16.1–24.5

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)