Aleurocanthus banksiae

(Maskell, 1896) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aleyrodidae/Aleurocanthus

At a glance

Occurrence records49

Data sources7

Biological traits0

DNA specimens19

eDNA detections19

Sources7 archives

Databases and archives Aleurocanthus banksiae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD19 specimens

01Narrative

Aleurocanthus banksiae is een halfvleugelig insect uit de familie witte vliegen (Aleyrodidae), onderfamilie Aleyrodinae. De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd door Maskell in 1896.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleurocanthus banksiae has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections19

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

349Tvariable

TCTTTATTTTGTTTTTGGTATTTGAAGCGGATTGATTGGTACTTCTATTAGTCTTTTGGTTCGCAGAGAGCTATTGGGGGTTGGGTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes5

BIN1

Most divergent pair0.46%

Oceania

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type49 records

Wild obs. + sensor12

Museum / vouchered37

Origin

Native2

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 1

7 georeferenced · 5 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 37 records without

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DPIlocation not on record	37

1 institutions · 37 of 37 vouchered records shown

09Environmental DNA19 detections

Where the DNA of Aleurocanthus banksiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 17.2–18.2

Seasonal swing summer↔winter14.5 °C

Max temp (day)23.0 °C 23.0–24.2

Min temp (night)11.7 °C 11.7–12.9

Precipitation48.1 mm/mo 25.0–48.1

Air humidity56.8 % 53.6–56.8

Moisture balance-58.5 mm/mo -90.3–-58.5

Vapour deficit850 Pa 850–972

Wind speed2.10 m/s 2.10–2.50

Cloud cover17.2 % 13.0–17.2

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)