Aletis helcita

(Linnaeus, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Aletis

At a glance

Occurrence records7

Data sources7

Biological traits0

DNA specimens6

eDNA detections3

Sources7 archives

Databases and archives Aletis helcita's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD6 specimens

01Narrative

Aletis helcita is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam is gepubliceerd in 1763 door Linnaeus. De soort komt voor in tropisch Afrika.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aletis helcita has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P610 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.6%

Haplotypes2

BINs2

Most divergent pair3.0%

Where individuals differ — all 18 variable positions, in barcode order

14Avariable

38Tvariable

53Cvariable

134Cvariable

176Tvariable

194Tvariable

200Gvariable

272Avariable

290Cvariable

296Tvariable

311Cvariable

317Cvariable

329Cvariable

356Avariable

464Avariable

575Avariable

584Avariable

596Tvariable

CATCTTTAAGATTATTAATTCGAGCCGAATTAGGTAATCCAGGATTTTTAATCGGAAATGATCAAATTTATAACACTATTGTTACTGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Manduca extremasame order10.8%Aletis concolorsame genus11.1%Scopula paneliusisame family11.1%Idaea nasiferasame family11.1%Clepsis pallidanasame order11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 records

Wild obs. + sensor2

Museum / vouchered5

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	2
ZSMlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1

3 institutions · 5 of 5 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Aletis helcita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)