Alepes kleinii

(Bloch, 1793) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Carangidae/Alepes

At a glance

Occurrence records1 108

Data sources9

Biological traits7

DNA specimens175

eDNA detections205

Sources9 archives

Databases and archives Alepes kleinii's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility521 records↗

OBISOcean Biodiversity Information System587 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI205 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics175 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS1 108 records

Environmental DNA1 datasets · 8 countries205 detections

DNA & barcodingBOLD175 specimens

01Narrative

The razorbelly scad (Alepes kleinii) (also known as the banded scad, golden scad and goggle-eye scad) is a small species of tropical marine fish in the jack family, Carangidae. The species inhabits coastal waters in the Indo-Pacific, from Pakistan in the west to Japan and Australia in the east, often found over reefs. The razorbelly scad has a complex taxonomic history, and even recently has had its position in the genus Alepes challenged, but appears to be stable after a molecular phylogeny study supported its placement in Alepes. It is very similar to other scads in the same genus, but is readily identified by its unique teeth. Razorbelly scad are predatory fish, taking a variety of crustaceans and shrimps, and show a change in feeding intensity over the year. Reproduction and development has been extensively studied in India, where spawning occurs in a single event from January to September. The species is commonly taken in tropical fisheries, where it is marketed fresh or dried.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length18.2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max100 m

Depth min5 m

Vulnerability16.09

05DNA & barcoding175 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alepes kleinii has left across the world's sequence archives.

At a glance

DNA specimens175

BINs2

Marker genes13

eDNA detections205

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus153 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

81Tmostly conserved

354Tmostly conserved

498Tmostly conserved

585Cmostly conserved

ATAGTAGGGACAGCTTTAAGCTTACTTATCCGAGCAGAACTTAGTCAACCTGGCGCCCTTTTAGGGGACGACCAAATTTATAACGTAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes21

BINs2

Most divergent pair7.8%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pantolabus radiatussame family7.1%Alepes djedabasame genus7.3%Atule matesame family11.2%Alepes varisame genus11.3%Alepes melanopterasame genus11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16SCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND612S

animal barcoderibosomalmitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_023524 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~5.03 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin5.03 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 108 records

Wild obs. + sensor424

Museum / vouchered673

Other11

Origin

Native2

Range

Area of Occupancy AOO1 548 km²

Depth

0–200 m sunlit229

200–1000 m twilight4

1–4 km midnight1

>4 km abyssal0

median 25 m · max 1 867 m · 234 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 21≤1 km 338≤10 km 5>10 km 8

372 georeferenced · 52 without coordinates

Open the mapobservation + sensor424

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 40≤1 km 106≤10 km 113>10 km 36

295 georeferenced · 378 without coordinates

Open the institutions mapphysical evidence673

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	70
DEWlocation not on record	30
Kagoshima University Museumlocation not on record	25
Sydney, AU	21
Natick, US	20
Mutare Museumlocation not on record	12
Museum and Art Gallery of the Northern Territorylocation not on record	12
Washington, US	9
Cambridge, US	7
Curtin Universitylocation not on record	6
Fisheries Research Laboratory, Mie Universitylocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Western Australian Museumlocation not on record	3
Louisiana State University, Museum of Zoologylocation not on record	2
Stockholm, SE	1
Museums Victorialocation not on record	1
Junagadh Agricultural University, College of Fisheries Sciencelocation not on record	1
Ann Arbor, US	1
Frankfurt am Main	1
	1

20 institutions · 231 of 673 vouchered records shown · 109 without an institution code

09Environmental DNA205 detections

Where the DNA of Alepes kleinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found205

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 205 detections have coordinates

Open the map8 countries0

CoralEstuaryMangrove

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 22.9–27.9

Seasonal swing summer↔winter8.90 °C

Max temp (day)27.5 °C 24.4–29.9

Min temp (night)23.9 °C 19.3–26.6

Precipitation139 mm/mo 27.9–328

Air humidity64.4 % 58.8–68.7

Vapour deficit1,193 Pa 962–1,332

Cloud cover48.6 % 25.2–68.7

CHELSA 1981–2010, ~9 km grid, at location & month of 120 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alepes kleinii

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

At a glance

When this lineage existed

Record type1 108 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 108 records