Aleochara brevipennis

Gravenhorst, 1806 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Aleochara

At a glance

Occurrence records1 829

Data sources6

Biological traits0

DNA specimens15

eDNA detections54

Sources6 archives

Databases and archives Aleochara brevipennis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 829 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 829 records

Environmental DNA4 datasets · 6 countries54 detections

DNA & barcodingBOLD15 specimens

01Narrative

Aleochara brevipennis is a species of rove beetles native to Europe.Fauna EuropaeaNorman H. Joy, , 1932 A Practical Handbook of British Beetles

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleochara brevipennis has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections54

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

36Tmostly conserved

508Amostly conserved

625Gmostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAACTTGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes3

BIN1

Most divergent pair0.30%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleochara tahoensissame genus7.8%Aleochara gracilicornissame genus8.1%Aleochara latasame genus9.0%Acrolocha sulculasame family10.0%Aleochara haemopterasame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 829 records

Wild obs. + sensor962

Museum / vouchered833

Cultivated / captive1

Other33

Range

Area of Occupancy AOO4 384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 561≤1 km 260≤10 km 80>10 km 2

903 georeferenced · 59 without coordinates

Open the mapobservation + sensor962

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 257≤1 km 274≤10 km 193>10 km 37

761 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence833

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	273
Olocation not on record	70
NHMOlocation not on record	61
Metsähallituslocation not on record	60
Helsinki, FI	59
Provincia di Livornolocation not on record	35
Tallinn, EE	23
NTNU-VMlocation not on record	17
neflocation not on record	14
Tartu, EE	12
Copenhagen, DK	11
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	9
Oulu, FI	9
LSMlocation not on record	8
Salzburg, AT	7
Trondheim, NO	6
Kuopio, FI	4
ZMAAlocation not on record	4
NMBU:MINAlocation not on record	3
BioFokuslocation not on record	3
State Museum of Nature History, Lvivlocation not on record	3
Tromsø, NO	2
WIlocation not on record	2
MZLUlocation not on record	2
Uniwersytet Wrocławskilocation not on record	2
CBDClocation not on record	2
ZSMlocation not on record	1
TMPMlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Akademia Pomorska w Słupskulocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
IFR-DNFlocation not on record	1
Norwegian University of Life Sciences (NMBU)location not on record	1

34 institutions · 709 of 833 vouchered records shown · 124 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA54 detections

Where the DNA of Aleochara brevipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys4

Countries6

Verifiable raw sequence linked13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map6 countries0

aufgel. SteinbruchTeichuferUrbanFluÃschotter

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 6.40–16.6

Seasonal swing summer↔winter17.2 °C

Max temp (day)17.2 °C 9.60–20.1

Min temp (night)10.6 °C 2.40–13.0

Precipitation64.9 mm/mo 50.4–84.1

Air humidity60.8 % 58.9–63.3

Moisture balance-47.2 mm/mo -69.0–22.1

Vapour deficit627 Pa 370–722

Wind speed3.80 m/s 2.50–5.30

Cloud cover43.6 % 37.6–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 54 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aleochara brevipennis

At a glance

Sources6 archives

At a glance

Record type1 829 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 829 records