Alentia gelatinosa

(M.Sars, 1835) · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Phyllodocida/Polynoidae/Alentia

At a glance

Occurrence records1 724

Data sources8

Biological traits2

DNA specimens13

eDNA detections18

Sources8 archives

Databases and archives Alentia gelatinosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 029 records↗

OBISOcean Biodiversity Information System695 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 724 records

Environmental DNA4 datasets · 4 countries18 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

Alentia gelatinosa is een borstelworm uit de familie Polynoidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Alentia gelatinosa werd in 1835 voor het eerst wetenschappelijk beschreven door M. Sars.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alentia gelatinosa has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections18

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

7Cmostly conserved

22Amostly conserved

70Cmostly conserved

397Cmostly conserved

399Cmostly conserved

452Amostly conserved

455Gmostly conserved

468Gmostly conserved

475Amostly conserved

484Tmostly conserved

488Gmostly conserved

500Tmostly conserved

505Tmostly conserved

508Cmostly conserved

511Amostly conserved

512Gmostly conserved

622Amostly conserved

623Gmostly conserved

628Amostly conserved

629Gmostly conserved

631Tmostly conserved

633Amostly conserved

634Tmostly conserved

635Cmostly conserved

636Cmostly conserved

637Gmostly conserved

638Gmostly conserved

639Tmostly conserved

640Cmostly conserved

641Cmostly conserved

643Tmostly conserved

644Tmostly conserved

645Amostly conserved

646Cmostly conserved

647Cmostly conserved

649Amostly conserved

652Tmostly conserved

653Tmostly conserved

654Tmostly conserved

655Amostly conserved

658Tmostly conserved

AACCCTCTACTTTATTTTCGGAACTTGATCCGGTCTCCTAGGCACATCTATGAGTCTTTTAATTCGAGCCGAATTAGGTCAACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes4

BIN1

Most divergent pair5.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lepidonotus tenuisetosussame family16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alentia gelatinosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 237 499 423 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alentia gelatinosa1.24 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.1% BUSCO

08Occurrence & distribution

Record type1 724 records

Wild obs. + sensor653

Museum / vouchered784

Other287

Range

Area of Occupancy AOO2 012 km²

Depth

0–200 m sunlit183

200–1000 m twilight3

1–4 km midnight0

>4 km abyssal0

median 21.4 m · max 333 m · 186 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 461≤1 km 34≤10 km 12>10 km 1

508 georeferenced · 145 without coordinates

Open the mapobservation + sensor653

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 51≤1 km 13≤10 km 5>10 km 4

73 georeferenced · 711 without coordinates

Open the institutions mapphysical evidence784

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut Francais pour l'Etude de la Merlocation not on record	126
486location not on record	79
CEFASlocation not on record	45
DASSHlocation not on record	44
PNHSlocation not on record	23
NTNU-VMlocation not on record	13
Gothenburg, SE	6
Bergen, NO	6
SLU Artdatabankenlocation not on record	5
Stockholm, SE	5
South Kensington, GB	3
Montgomery, US	2
ARMS-MBONlocation not on record	2
Norwegian Institute of Marine Researchlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Frankfurt am Main	2
Natural History Museum Rotterdamlocation not on record	2
Tapachula, MX	1
730location not on record	1
Stockholm, SE	1

20 institutions · 370 of 784 vouchered records shown · 4 without an institution code

09Environmental DNA18 detections

Where the DNA of Alentia gelatinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys4

Countries4

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map4 countries0

Industrial port; industrial; 9.4 - Subtidal …Under rock, course sand and shell

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.6 °C 5.00–15.7

Seasonal swing summer↔winter14.6 °C

Max temp (day)13.0 °C 6.10–18.1

Min temp (night)7.00 °C 1.40–12.9

Precipitation73.5 mm/mo 54.1–206

Air humidity62.1 % 58.7–64.5

Moisture balance-36.6 mm/mo

Vapour deficit494 Pa 319–661

Wind speed4.80 m/s

Cloud cover49.6 % 42.5–62.6

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alentia gelatinosa

At a glance

Sources8 archives

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 724 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 724 records