Aleiodes terminalis

Cresson, 1869 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aleiodes

At a glance

Occurrence records233

Data sources4

Biological traits0

DNA specimens27

eDNA detections27

Sources4 archives

Databases and archives Aleiodes terminalis's data was compiled from.

GBIFGlobal Biodiversity Information Facility233 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF233 records

Environmental DNA1 datasets · 2 countries27 detections

DNA & barcodingBOLD27 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleiodes terminalis has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes1

eDNA detections27

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes1

BIN1

ATCTTATACTTTTTATTTGGGATATGAGCAGGTATAATTGGTATATCAATAAGATTAATTATTCGATTAGAATTAGGAACTTGTGGAAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleiodes pseudoterminalissame genus7.3%Aleiodes unipunctatorsame genus9.5%Aleiodes grassatorsame genus9.5%Aleiodes ruficornissame genus9.5%Aleiodes gasteratorsame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type233 records

Wild obs. + sensor15

Museum / vouchered218

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 4≤1 km 8≤10 km 1>10 km 2

15 georeferenced

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 16≤1 km 41≤10 km 96>10 km 15

168 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	148
Wuzhou, CN	58
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
Cambridge, US	4
Universidad Católica de Manizaleslocation not on record	1

5 institutions · 216 of 218 vouchered records shown · 2 without an institution code

09Environmental DNA27 detections

Where the DNA of Aleiodes terminalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map2 countries0

4. Native GrasslandMixed HabitatBeachForest14. Artificial - Terrestrial|14.5 Urban Areas14. Artificial - Terrestrial|14.1 Arable Land

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 15.2–21.2

Seasonal swing summer↔winter26.9 °C

Max temp (day)23.7 °C 18.1–26.9

Min temp (night)14.1 °C 11.3–17.1

Precipitation86.6 mm/mo 68.2–117

Air humidity58.7 % 54.0–62.2

Moisture balance-41.6 mm/mo -75.6–-3.90

Vapour deficit893 Pa 673–1,111

Wind speed3.00 m/s 2.30–4.40

Cloud cover41.1 % 35.6–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)