Aleiodes gastritor

(Thunberg, 1822) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aleiodes

At a glance

Occurrence records132

Data sources6

Biological traits0

DNA specimens75

eDNA detections31

Sources6 archives

Databases and archives Aleiodes gastritor's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility132 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF132 records

Environmental DNA3 datasets · 6 countries31 detections

DNA & barcodingBOLD75 specimens

01Narrative

Aleiodes gastritor is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Thunberg in 1822.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleiodes gastritor has left across the world's sequence archives.

At a glance

DNA specimens75

BINs7

Marker genes1

eDNA detections31

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

2Gmostly conserved

4Tmostly conserved

13Cmostly conserved

22Avariable

34Gvariable

43Tmostly conserved

56Tmostly conserved

67Amostly conserved

79Gvariable

82Gvariable

83Gmostly conserved

85Tmostly conserved

88Amostly conserved

94Tmostly conserved

175Amostly conserved

181Amostly conserved

184Gmostly conserved

217Amostly conserved

278Cvariable

293Amostly conserved

301Tmostly conserved

302Gmostly conserved

316Avariable

340Tmostly conserved

343Tvariable

364Amostly conserved

367Tmostly conserved

382Avariable

409Amostly conserved

412Tmostly conserved

427Cvariable

442Tmostly conserved

445Tmostly conserved

477Cvariable

481Cmostly conserved

490Cmostly conserved

500Cvariable

539Cmostly conserved

565Amostly conserved

616Tmostly conserved

619Tmostly conserved

625Tvariable

631Amostly conserved

634Tvariable

640Cmostly conserved

646Tmostly conserved

AGTTTTATATTTCTTATTTGGAATATGAGCAGGGATAATTGGTATATCAATAAGATTAATTATTCGATTAGAATTAAGGTCGGGTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes12

BINs7

Most divergent pair5.0%

EuropeN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleiodes circumscriptussame genus3.0%Aleiodes borealissame genus6.1%Aleiodes bobandersonisame genus7.1%Aleiodes granulatussame genus7.2%Aleiodes alessandracallejaesame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type132 records

Wild obs. + sensor27

Museum / vouchered105

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 13≤1 km 2≤10 km 12

27 georeferenced

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 36≤10 km 13

49 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	31
Stockholm, SE	17
Wuzhou, CN	17
South Kensington, GB	9
Helsinki, FI	8
Cambridge, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Natural History Museum, Londonlocation not on record	3
Finnish Museum of Natural History, Zoological Museumlocation not on record	1
Swedish Museum of Natural Historylocation not on record	1
University of Edinburghlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

12 institutions · 97 of 105 vouchered records shown · 8 without an institution code

09Environmental DNA31 detections

Where the DNA of Aleiodes gastritor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys3

Countries6

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map6 countries0

GrasslandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 8.40–16.2

Seasonal swing summer↔winter21.8 °C

Max temp (day)18.2 °C 10.3–23.2

Min temp (night)10.8 °C 4.40–12.2

Precipitation71.1 mm/mo 57.7–112

Air humidity59.6 % 52.6–64.4

Moisture balance-26.8 mm/mo -63.6–27.0

Vapour deficit666 Pa 410–882

Wind speed2.60 m/s 2.30–4.30

Cloud cover46.5 % 31.4–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)