Alectura lathami

J.E.Gray, 1831 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Galliformes/Megapodiidae/Alectura

At a glance

Occurrence records223 497

Data sources12

Biological traits35

DNA specimens17

eDNA detections7

Sources12 archives

Databases and archives Alectura lathami's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility223 497 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF223 497 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceGoaT · NCBI≈1 Gbp

01Narrative

Cairns, Queensland, Australia 'Mr Albines', a male Australian brushturkey (albino) in Noosa, Queensland, Australia The Australian brushturkey or Australian brush-turkey or gweela (Alectura lathami), also frequently called the scrub turkey or bush turkey, is a common, widespread species of mound-building bird from the family Megapodiidae found in eastern Australia from Far North Queensland to Eurobodalla on the South Coast of New South Wales. The Australian brushturkey has also been introduced to Kangaroo Island in South Australia. It is the largest extant representative of the family Megapodiidae, and is one of three species to inhabit Australia. Despite its name and their superficial similarities, the bird is not closely related to American turkeys, nor to the Australian bustard, which is also known as the bush turkey. Its closest relatives are the wattled brushturkey, Waigeo brushturkey, and malleefowl.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAnAgeAVONET

Size & morphology14

Beak depth17.4 mm

Beak length (culmen)37.8 mm

Beak length (nares)20.9 mm

Beak width12 mm

Body mass2 340 g

Body mass (female)2 160 g

Body mass (male)2 520 g

Hand-wing index21.4

Kipp's distance61.7 mm

SVL65 cm

Secondary length228 mm

Tail length218 mm

Tarsus length80.6 mm

Wing length290 mm

Life cycle & reproduction9

Egg length93.8 mm

Egg mass185 g

Egg width59.1 mm

Growth rate0.03 /day

Incubation42 days

Litter size14.78

Litters per year21 /year

Max. longevity150 months

Neonate mass80 g

Diet & foraging8

Fruit20 %

Ground80 %

Invertebrate20 %

Plant other40 %

Seed20 %

Trophic levelherbivore

Trophic nicheOmnivore

Understory20 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleTerrestrial

Range size642 830 km²

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alectura lathami has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes11

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

184Cvariable

349Tvariable

CCTATATCTGATTTTCGGCACATGAGCAGGCATAATTGGCACTGCACTAAGCCTCTTAATCCGTGCAGAACTAGGTCAACCCGGAACACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes3

BIN1

Most divergent pair0.31%

OtherOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megapodius nicobariensissame family13.9%Psittacus erithacussame order15.9%Terathopius ecaudatussame order15.9%Pterodroma axillarissame order16.3%Himantopus novaezelandiaesame order16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_007227 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND6s-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alectura lathami carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 043 215 352 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alectura lathami1.04 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness93.5% BUSCO

07Deep time~2.41 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin2.41 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Environmentterrestrial

Life habitvolant

Dietherbivore

Motilityactively mobile

Compositionhydroxyapatite

Reproductionoviparous, dispersal=direct/internal,mobile

Ontogenyaccretion,modification of parts

08Occurrence & distribution

Record type223 497 records

Wild obs. + sensor219 882

Museum / vouchered247

Other3 368

Origin

Native8

Range

Area of Occupancy AOO36 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 40 881≤1 km 9 413≤10 km 7 803>10 km 2 050

60 147 georeferenced · 159 735 without coordinates

Open the mapobservation + sensor219 882

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 8≤1 km 17≤10 km 111>10 km 17

153 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Wildlife Collectionlocation not on record	99
Sydney, AU	42
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	27
Seattle, US	19
Museums Victorialocation not on record	16
Natick, US	6
Cambridge, US	5
Western Australian Museumlocation not on record	5
New Haven, US	4
Philadelphia, US	3
Chicago, US	3
Denver, US	2
SNSDlocation not on record	2
Auckland, NZ	2
Honolulu, US	2
QVMAGlocation not on record	2
Geneva, CH	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
Zografou, GR	1
US	1
Natural History Museum Rotterdamlocation not on record	1
Ann Arbor, US	1

22 institutions · 245 of 247 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Alectura lathami was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 24.6–24.6

Seasonal swing summer↔winter9.20 °C

Max temp (day)26.8 °C

Min temp (night)22.2 °C

Precipitation164 mm/mo

Air humidity61.2 %

Vapour deficit1,194 Pa

Cloud cover33.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alectura lathami

At a glance

Sources12 archives

Size & morphology14

Life cycle & reproduction9

Diet & foraging8

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

How it livedPBDB

Record type223 497 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type223 497 records