Alectoria imshaugii

Brodo & Hawksw. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Parmeliaceae/Alectoria

At a glance

Occurrence records212

Data sources6

Biological traits1

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Alectoria imshaugii's data was compiled from.

GBIFGlobal Biodiversity Information Facility212 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF212 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alectoria imshaugii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences8

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEU282496.1 ↗478 bp

ACGT

CCGAGAGAGGGGCCTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCATTGCGTACCTACTTTGTTGCTTTGGCGGGCCTCGGGG …

Alectoria imshaugii voucher Goward 05-32 (HERB. GOWARD) internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

08Occurrence & distribution

Record type212 records

Wild obs. + sensor21

Museum / vouchered186

Other5

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 10≤1 km 2≤10 km 1>10 km 1

14 georeferenced · 7 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 2≤1 km 15≤10 km 21>10 km 2

40 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence186

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	24
Boise, US	23
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	16
ASUlocation not on record	14
Madison, US	12
Vancouver, CA	9
Durham, US	7
LDlocation not on record	7
Bronx, US	5
Bureau of Land Management, Medford District Officelocation not on record	5
Arcata, US	4
CASlocation not on record	4
St. Paul, US	4
University of Stellenboschlocation not on record	4
Wuzhou, CN	3
US	3
DOI/NPS, Colonial National Historical Parklocation not on record	3
Philadelphia, US	2
Berlin, DE	2
Chapel Hill, US	2
Santa Barbara, US	2
Stockholm, SE	2
FLASlocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Bozeman, US	1
National Biodiversity Institute, Costa Ricalocation not on record	1
Portland, US	1
EL PASO, US	1
ILLSlocation not on record	1
Göteborg, SE	1
Bergen, NO	1
Olocation not on record	1
GZUlocation not on record	1
Helsinki, FI	1
Chicago, US	1
Edmonton, CA	1
Uppsala, SE	1
McWane Science Centerlocation not on record	1

38 institutions · 175 of 186 vouchered records shown · 11 without an institution code

09Environmental DNA2 detections

Where the DNA of Alectoria imshaugii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)