Aldisa zetlandica

(Alder & Hancock, 1854) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Cadlinidae/Aldisa

At a glance

Occurrence records248

Data sources8

Biological traits4

DNA specimens11

eDNA detections11

Sources8 archives

Databases and archives Aldisa zetlandica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility182 records↗

OBISOcean Biodiversity Information System66 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS248 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Aldisa zetlandica is a species of sea slug, a dorid nudibranch, a marine gastropod mollusc in the family Cadlinidae.Gofas, S. (2014). Aldisa zetlandica (Alder & Hancock, 1854). Accessed through: World Register of Marine Species on 2015-03-09

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max1 900 m

Depth min25 m

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aldisa zetlandica has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

71Gvariable

172Avariable

253Avariable

268Cvariable

292Avariable

343Cmostly conserved

380Gvariable

412Avariable

415Gmostly conserved

416Gmostly conserved

417Cmostly conserved

418Tmostly conserved

559Avariable

607Avariable

631Cvariable

TACATTATATATTATTTTTGGTATATGGTGTGGTTTATTAGGAACTGGATTAAGTTTACTGATTCGGTTTGAATTAGGTACAGCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.98%

Haplotypes3

BINs2

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cadlina laevissame order14.2%Limacia clavigerasame order14.8%Kaloplocamus doktesame order15.1%Atalodoris sparsasame order15.3%Acanthodoris pinasame order16.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type248 records

Wild obs. + sensor166

Museum / vouchered79

Other3

Range

Area of Occupancy AOO476 km²

Depth

0–200 m sunlit58

200–1000 m twilight5

1–4 km midnight0

>4 km abyssal0

median 88 m · max 319.5 m · 63 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 135≤1 km 6≤10 km 2

143 georeferenced · 23 without coordinates

Open the mapobservation + sensor166

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 19≤1 km 11≤10 km 3>10 km 1

34 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	24
Bergen, NO	7
Gothenburg, SE	4
SLU Artdatabankenlocation not on record	4
Maurice Lamontagne Institutelocation not on record	4
Tromsø, NO	3
Norwegian Institute of Marine Researchlocation not on record	3
CEFASlocation not on record	2
Washington, US	1

9 institutions · 52 of 79 vouchered records shown · 2 without an institution code

09Environmental DNA11 detections

Where the DNA of Aldisa zetlandica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

RockOn bryozoan (Mebranipora membranacea) on kelpHard substrateOn kelp

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median2.70 °C -0.6–10.5

Seasonal swing summer↔winter12.9 °C

Max temp (day)3.60 °C 1.60–12.2

Min temp (night)0.5 °C -4.80–7.20

Precipitation91.8 mm/mo 35.3–226

Air humidity63.5 % 60.9–65.9

Moisture balance197 mm/mo

Vapour deficit269 Pa 231–465

Wind speed4.60 m/s

Cloud cover54.5 % 52.5–73.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)