Alcyonium acaule

Marion, 1878 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Malacalcyonacea/Alcyoniidae/Alcyonium

At a glance

Occurrence records1 511

Data sources8

Biological traits2

DNA specimens7

eDNA detections2

Sources8 archives

Databases and archives Alcyonium acaule's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 432 records↗

OBISOcean Biodiversity Information System79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 511 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD7 specimens

01Narrative

Alcyonium acaule or Mediterranean sea-finger is a species of soft coral in the family Alcyoniidae. It is found at moderate depths on shaded rocks in the Mediterranean Sea and adjoining parts of the Atlantic Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcyonium acaule has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 710 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ATGAACAAATATCTTACACGTTGGCTATTTTCTACTAATCATAAGGATATAGGTACTTTATATTTAATATTTGGTGCTTTTTCTGGGATG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_061273 ↗ · 14 protein · 1 tRNA · 2 rRNA

ND2ND5ND4COX3ATP6ATP8COX2COX1ND1CYTBND6ND3ND4LmutSrnlrns

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 511 records

Wild obs. + sensor1 399

Museum / vouchered46

Other66

Origin

Native5

Range

Area of Occupancy AOO1 060 km²

Depth

0–200 m sunlit62

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 54.1 m · max 416 m · 64 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 187≤1 km 82≤10 km 14>10 km 12

295 georeferenced · 1 104 without coordinates

Open the mapobservation + sensor1 399

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	18
ICATMARlocation not on record	3
CASlocation not on record	1
AUTHlocation not on record	1
UB_ICMlocation not on record	1

5 institutions · 24 of 46 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Alcyonium acaule was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alcyonium acaule

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type1 511 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 511 records