Alcis picata

(Butler, 1881) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Alcis

At a glance

Occurrence records60

Data sources7

Biological traits0

DNA specimens9

eDNA detections1

Sources7 archives

Databases and archives Alcis picata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF60 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD9 specimens

01Narrative

Alcis picata is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1881 door Butler.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcis picata has left across the world's sequence archives.

At a glance

DNA specimens9

BINs4

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 81 variable positions, in barcode order

23Amostly conserved

34Avariable

37Avariable

38Amostly conserved

56Cvariable

59Tmostly conserved

82Tvariable

88Avariable

92Tmostly conserved

100Amostly conserved

118Cvariable

124Tmostly conserved

133Cvariable

145Cvariable

169Cvariable

172Cvariable

181Gmostly conserved

184Tvariable

202Amostly conserved

211Amostly conserved

214Amostly conserved

229Avariable

232Avariable

235Cvariable

238Amostly conserved

247Tmostly conserved

259Tmostly conserved

263Cvariable

265Tvariable

266Tmostly conserved

271Amostly conserved

283Tvariable

295Tmostly conserved

301Amostly conserved

307Avariable

322Tvariable

337Amostly conserved

340Cvariable

343Cmostly conserved

346Cmostly conserved

347Cvariable

349Amostly conserved

352Tmostly conserved

358Cmostly conserved

361Tmostly conserved

364Tmostly conserved

373Amostly conserved

397Cvariable

400Avariable

412Avariable

421Tmostly conserved

427Tmostly conserved

433Amostly conserved

457Tmostly conserved

460Tmostly conserved

463Cmostly conserved

475Cvariable

490Tmostly conserved

505Tmostly conserved

508Tmostly conserved

515Gmostly conserved

532Cvariable

536Cmostly conserved

538Amostly conserved

541Cvariable

542Cmostly conserved

544Cvariable

548Cmostly conserved

550Amostly conserved

556Tmostly conserved

574Tvariable

586Tvariable

589Cmostly conserved

604Tmostly conserved

625Amostly conserved

628Avariable

634Cmostly conserved

646Cvariable

652Cmostly conserved

653Cvariable

658Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCTTTAAGACTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.2%

Haplotypes4

BINs4

Most divergent pair7.6%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alcis bastelbergerisame genus3.6%Alcis deversatasame genus3.7%Alcis castigatariasame genus4.4%Hypomecis castigatariasame family4.5%Alcis repandatasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type60 records

Wild obs. + sensor3

Museum / vouchered57

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 4

5 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	24
KIRMlocation not on record	10
JP	6
ZSMlocation not on record	4
Tartu, EE	4
KOMlocation not on record	2
NSMKlocation not on record	2
Iwate Prefectural Museumlocation not on record	1
HUNMlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Tomioka, JP	1
National Institute for Agro-Environmental Scienceslocation not on record	1

12 institutions · 57 of 57 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Alcis picata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 16.8–16.8

Seasonal swing summer↔winter33.9 °C

Max temp (day)21.1 °C

Min temp (night)11.2 °C

Precipitation109 mm/mo

Air humidity58.0 %

Moisture balance-35.7 mm/mo

Vapour deficit803 Pa

Wind speed5.30 m/s

Cloud cover38.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)