Alcis angulifera

(Butler, 1878) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Alcis

At a glance

Occurrence records1 499

Data sources7

Biological traits0

DNA specimens98

eDNA detections102

Sources7 archives

Databases and archives Alcis angulifera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 499 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI102 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics98 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 499 records

Environmental DNA1 datasets · 3 countries102 detections

DNA & barcodingBOLD98 specimens

01Narrative

Alcis angulifera is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1878 door Butler.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding98 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcis angulifera has left across the world's sequence archives.

At a glance

DNA specimens98

BINs4

Marker genes2

eDNA detections102

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P621 bp consensus95 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 95 variable positions, in barcode order

3Tmostly conserved

15Amostly conserved

21Gmostly conserved

30Amostly conserved

42Amostly conserved

44Tmostly conserved

45Gmostly conserved

48Tmostly conserved

51Gmostly conserved

60Cvariable

63Amostly conserved

69Cmostly conserved

90Amostly conserved

93Cmostly conserved

123Amostly conserved

132Amostly conserved

135Cmostly conserved

144Amostly conserved

147Tmostly conserved

153Gmostly conserved

168Tmostly conserved

169Tmostly conserved

177Gmostly conserved

180Tmostly conserved

183Cmostly conserved

186Amostly conserved

192Amostly conserved

195Amostly conserved

198Cmostly conserved

234Cmostly conserved

247Tmostly conserved

258Cmostly conserved

270Gmostly conserved

279Gmostly conserved

282Gmostly conserved

285Cmostly conserved

291Tmostly conserved

303Tmostly conserved

306Cmostly conserved

309Cmostly conserved

315Cmostly conserved

318Tmostly conserved

321Cmostly conserved

324Cmostly conserved

333Amostly conserved

345Amostly conserved

363Cmostly conserved

366Gmostly conserved

384Amostly conserved

396Gmostly conserved

408Tmostly conserved

411Cmostly conserved

420Tmostly conserved

441Cmostly conserved

450Cmostly conserved

462Tmostly conserved

477Amostly conserved

483Amostly conserved

489Tmostly conserved

495Cmostly conserved

496Tmostly conserved

499Tmostly conserved

504Tmostly conserved

505Tmostly conserved

510Amostly conserved

513Gmostly conserved

516Cmostly conserved

525Tmostly conserved

537Cmostly conserved

541Tmostly conserved

546Gmostly conserved

558Cmostly conserved

567Amostly conserved

585Tmostly conserved

588Gmostly conserved

591Avariable

592Gmostly conserved

594Tvariable

595Gmostly conserved

596Amostly conserved

597Cvariable

600Avariable

602Tmostly conserved

604Cvariable

605Tmostly conserved

606Tmostly conserved

608Amostly conserved

609Tmostly conserved

610Cmostly conserved

611Amostly conserved

613Cmostly conserved

614Amostly conserved

615Tmostly conserved

618Amostly conserved

619Tmostly conserved

GTTGGAACTTCTCTAAGATTGTTAATTCGAGCAGAATTAGGAATGCCTGGGTCATTAATCGGAGATGACCAAATTTATAATACTATTGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.6%

Haplotypes14

BINs4

Most divergent pair13.0%

OtherAsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rikiosatoa griseasame family8.8%Alcis castigatariasame genus8.9%Alcis praevariegatasame genus9.0%Alcis variegatasame genus9.2%Lassaba acribomenasame family9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 499 records

Wild obs. + sensor899

Museum / vouchered600

Range

Area of Occupancy AOO2 392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 28≤1 km 6≤10 km 5>10 km 8

47 georeferenced · 852 without coordinates

Open the mapobservation + sensor899

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 78≤10 km 1

79 georeferenced · 521 without coordinates

Open the institutions mapphysical evidence600

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kawasaki Shi Tama Ku, JP	118
Sagamihara, JP	110
Chiba, JP	100
Hiwa Museum of Natural Historylocation not on record	78
KNAMlocation not on record	75
NSMKlocation not on record	36
KOMlocation not on record	20
ZSMlocation not on record	11
Shiojiri City Museum of Natural Historylocation not on record	11
HUNMlocation not on record	10
Capital Normal University, College of Life Scienceslocation not on record	10
RCMlocation not on record	6
Iwate Prefectural Museumlocation not on record	4
Toyota city nature sanctuarylocation not on record	4
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	3
JP	1
Tomioka, JP	1
National Institute for Agro-Environmental Scienceslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

19 institutions · 600 of 600 vouchered records shown

09Environmental DNA102 detections

Where the DNA of Alcis angulifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found102

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 102 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 15.2–20.8

Seasonal swing summer↔winter21.3 °C

Max temp (day)20.9 °C 16.6–25.7

Min temp (night)17.3 °C 13.6–18.0

Precipitation166 mm/mo 86.7–190

Air humidity70.0 % 52.6–70.0

Moisture balance52.7 mm/mo -61.6–52.7

Vapour deficit678 Pa 589–1,151

Wind speed3.90 m/s 2.80–4.50

Cloud cover41.8 % 38.0–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 62 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alcis angulifera

At a glance

Sources7 archives

At a glance

Record type1 499 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 499 records