Alcides metaurus

Hopffer, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Uraniidae/Alcides

At a glance

Occurrence records765

Data sources7

Biological traits0

DNA specimens16

eDNA detections57

Sources7 archives

Databases and archives Alcides metaurus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility765 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF765 records

Environmental DNA1 datasets · 5 countries57 detections

DNA & barcodingBOLD16 specimens

01Narrative

Alcides metaurus ventral view Alcides metaurus is a moth of the family Uraniidae. It is known from the tropical north of Queensland, Australia.Alcides metaurus (Hopffer, 1856) . lepidoptera.butterflyhouse.com.au The wingspan is about 100 mm. Adults are black with iridescent bands of yellow and pink. The underside is iridescent pale green with black bands. They are on wing during the day and feed on flower nectar. They rest with their wings open and out flat. The larvae feed on various Euphorbiaceae species, including Endospermum medullosum, E. myrmecophilum, and Omphalea queenslandiae. These plants contain poisons which might protect the larvae from predation. The various instars have colours varying from green with a black band, to black with white bands and a red thorax, to red with black bands and orange legs. Pupation takes place in a cocoon made in a crevice or between dead leaves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcides metaurus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections57

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

25Tmostly conserved

34Amostly conserved

415Amostly conserved

478Tmostly conserved

533Tvariable

631Tmostly conserved

632Gmostly conserved

633Amostly conserved

634Tmostly conserved

635Cmostly conserved

637Tvariable

638Amostly conserved

639Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Tmostly conserved

647Cmostly conserved

648Amostly conserved

650Cmostly conserved

651Amostly conserved

652Tmostly conserved

655Amostly conserved

656Tmostly conserved

658Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes8

BIN1

Most divergent pair3.3%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lyssa menoetiussame family6.1%Agrotera scissalissame order6.4%Lyssa macleayisame family7.0%Cyana sanguineasame order7.0%Phocoderma betissame order7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type765 records

Wild obs. + sensor737

Museum / vouchered28

Range

Area of Occupancy AOO1 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 328≤1 km 154≤10 km 55>10 km 48

585 georeferenced · 152 without coordinates

Open the mapobservation + sensor737

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	6
Natick, US	6
Musée des Confluenceslocation not on record	4
New Haven, US	2
Tallinn, EE	2
Auckland, NZ	2
Cornell University Insect Collectionlocation not on record	1
Sydney, AU	1

8 institutions · 24 of 28 vouchered records shown · 4 without an institution code

09Environmental DNA57 detections

Where the DNA of Alcides metaurus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 21.7–26.6

Seasonal swing summer↔winter2.30 °C

Max temp (day)29.5 °C 25.4–30.4

Min temp (night)22.1 °C 19.2–23.5

Precipitation294 mm/mo 116–564

Air humidity68.1 % 61.3–72.6

Moisture balance183 mm/mo

Vapour deficit1,064 Pa 797–1,204

Wind speed1.00 m/s

Cloud cover55.4 % 35.4–63.1

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)