Alcichthys elongatus

(Steindachner, 1881) · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Cottidae/Alcichthys

At a glance

Occurrence records583

Data sources11

Biological traits7

DNA specimens70

eDNA detections71

Sources11 archives

Databases and archives Alcichthys elongatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility119 records↗

OBISOcean Biodiversity Information System464 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics70 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS583 records

Environmental DNA1 datasets · 3 countries71 detections

DNA & barcodingBOLD70 specimens

Genome at a glanceGoaT2n = 48

01Narrative

Alcichthys elongatus is a fish in the family Cottidae (sculpins), and the only valid member of its genus.Species listing for Alcichthys at www.fishbase.org. It was described by Franz Steindachner in 1881.Steindachner, F., 1881 Ichthyologische Beiträge (X). Sitzungsberichte der Kaiserlichen Akademie der Wissenschaften. Mathematisch-Naturwissenschaftliche Classe v. 83 (1. Abth.): 179-219, Pls. 1-8. It is a marine, boreal fish which is known from the northwestern Pacific Ocean, including the Sea of Okhotsk and Japan. It dwells at a depth range of 15 to, and inhabits rocky reefs. Males can reach a maximum total length of 44 cm, but more commonly reach a TL of 31.5 cm. The maximum recorded weight is 1 kg. A. elongatus aggregates during the winter. In the Russian Federation, its spawning season has been reported to occur from April to June. It is preyed on by Gadus macrocephalus (the Pacific cod), Hemitripterus villosus, and Hexagrammos otakii. Its own diet consists of bony fish such as Engraulis japonicus and Sardinops sagax, crabs such as Erimacrus isenbeckii, Oregonia gracilis and spider crabs, euphausiids such as Euphausia pacifica, as well as cephalopods, polychaetes, and debris. Due to its wide distribution in its region, as well as a lack of known threats, save for rare occasions in which it is caught in gill nets, the IUCN redlist currently lists A. elongatus as least concern.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length44 cm

Body mass1 000 g

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max269 m

Depth min15 m

Vulnerability34

05DNA & barcoding70 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcichthys elongatus has left across the world's sequence archives.

At a glance

DNA specimens70

BINs2

Marker genes1

eDNA detections71

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P595 bp consensus70 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

157Tmostly conserved

168Gmostly conserved

426Cmostly conserved

CTAAGCCTCCTAATTCGAGCTGAGCTAAGCCAACCCGGCGCCCTTTTAGGGGACGACCAGATTTATAACGTAATTGTTACAGCTCATGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes19

BINs2

Most divergent pair6.1%

AsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bero eleganssame family5.4%Icelinus borealissame family8.9%Trichocottus brashnikovisame family10.4%Icelus ecornissame family10.4%Icelinus burchamisame family10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_082283 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBrrnSrrnL

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Alcichthys elongatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type583 records

Wild obs. + sensor2

Museum / vouchered581

Range

Area of Occupancy AOO388 km²

Depth

0–200 m sunlit147

200–1000 m twilight22

1–4 km midnight0

>4 km abyssal0

median 76.9 m · max 263 m · 169 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 3

7 georeferenced · 574 without coordinates

Open the institutions mapphysical evidence581

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	105
Kagoshima University Museumlocation not on record	7
Washington, US	2
Vancouver, CA	1
Tomioka, JP	1

5 institutions · 116 of 581 vouchered records shown · 1 without an institution code

09Environmental DNA71 detections

Where the DNA of Alcichthys elongatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median0.2 °C -2.40–15.4

Seasonal swing summer↔winter25.4 °C

Max temp (day)4.60 °C -0.9–17.8

Min temp (night)-5.00 °C -6.90–11.0

Precipitation346 mm/mo 189–434

Air humidity64.1 % 58.3–68.2

Moisture balance225 mm/mo 104–399

Vapour deficit273 Pa 164–629

Wind speed3.20 m/s 2.50–3.50

Cloud cover40.9 % 37.2–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)