Alcedo quadribrachys

Bonaparte, 1850 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Coraciiformes/Alcedinidae/Alcedo

At a glance

Occurrence records3 145

Data sources10

Biological traits24

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Alcedo quadribrachys's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 145 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF3 145 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

Genome at a glanceGoaT · NCBI≈1 Gbp

01Narrative

The shining-blue kingfisher (Alcedo quadribrachys) is a species of bird in the family Alcedinidae. It is found in Equatorial Africa. The shining-blue kingfisher was described of by the French ornithologist Charles Lucian Bonaparte in 1850 and given its current binomial name Alcedo quadribrachys. The name Alcedo is the Latin word for a "kingfisher". The specific epithet quadribrachys is from the Latin quadri- for "four" and brachium meaning "arms" or in this case "toes". The shining-blue kingfisher is one of seven species in the genus Alcedo and is most closely related to the half-collared kingfisher (Alcedo semitorquata). There are two subspecies: A. q. quadribrachys Bonaparte, 1850 – Senegal and Gambia to west central Nigeria A. q. guentheri Sharpe, 1892 – southern Nigeria to Kenya, northwest Zambia and north Angola Subspecies A. q. quadribrachys (top) and A. q. guentheri (bottom); illustration by Keulemans, 1892

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth9.2 mm

Beak length (culmen)48.4 mm

Beak length (nares)36.5 mm

Beak width7.3 mm

Body mass34.9 g

Body mass (female)36.8 g

Body mass (male)34.3 g

Hand-wing index25.8

Kipp's distance20 mm

Secondary length57.6 mm

Tail length36 mm

Tarsus length11.8 mm

Wing length77.1 mm

Life cycle & reproduction2

Egg mass4.4 g

Litter size5.5

Diet & foraging5

Fish80 %

Invertebrate20 %

Trophic levelcarnivore

Trophic nicheAquatic predator

Water below surface100 %

Habitat & environment4

HabitatWetland

Migration1.0

Primary lifestyleInsessorial

Range size4 674 328 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcedo quadribrachys has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

58Tvariable

CTTATATCTAATCTTTGGTGCATGAGCAGGTATAATCGGCACTGCCCTAAGCCTCCTTATCCGCGCCGAATTAGGTCAACCGGGCACACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alcedo atthissame genus8.1%Ceyx websterisame family11.2%Ceyx cyanopectussame family11.3%Ceyx azureussame family11.3%Ceyx lepidussame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alcedo quadribrachys carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 031 140 142 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alcedo quadribrachys1.03 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~1.96 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.96 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type3 145 records

Wild obs. + sensor3 109

Museum / vouchered29

Other7

Origin

Native4

Range

Area of Occupancy AOO2 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 176≤1 km 44≤10 km 32>10 km 8

260 georeferenced · 2 849 without coordinates

Open the mapobservation + sensor3 109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	11
Texas Cooperative Wildlife Collectionlocation not on record	5
Philadelphia, US	4
	3
Washington State University, Charles R. Conner Museumlocation not on record	1
Washington, US	1
Musée des Confluenceslocation not on record	1

7 institutions · 26 of 29 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Alcedo quadribrachys was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 24.3–25.5

Seasonal swing summer↔winter3.80 °C

Max temp (day)29.0 °C 28.2–29.0

Min temp (night)22.8 °C 21.2–22.8

Precipitation221 mm/mo 64.8–221

Air humidity73.4 % 67.8–73.4

Moisture balance112 mm/mo -25.5–112

Vapour deficit865 Pa 865–971

Wind speed0.7 m/s 0.7–1.10

Cloud cover63.6 % 56.7–63.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alcedo quadribrachys

At a glance

Sources10 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging5

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type3 145 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 145 records