Alburnus vistonicus — The Life Data

Animalia/Chordata/Cypriniformes/Cyprinidae/Alburnus

At a glance

Occurrence records28

Data sources7

Biological traits4

DNA specimens31

eDNA detections0

Sources7 archives

Databases and archives Alburnus vistonicus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF28 records

DNA & barcodingBOLD31 specimens

01Narrative

Alburnus vistonicus is a species of ray-finned fish in the genus Alburnus that is endemic to the Lake Vistonida drainage in Greece. This species reaches a maximum length of 21.7 cm (SL).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length21.7 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability16.47

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alburnus vistonicus has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 1 variable positions, in barcode order

240Cmostly conserved

CCCTAAGCCTCCTTATCCGGGCCGAACTAAGCCAGCCTGGGTCACTCTTAGGTGATGATCAAATTTATAATGTCATCGTTACCGCCCACG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alburnus doriaesame genus2.4%Alburnus escherichiisame genus3.1%Alburnus thessalicussame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type28 records

Museum / vouchered28

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 28 records without

Open the institutions mapphysical evidence28

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	27

1 institutions · 27 of 28 vouchered records shown · 1 without an institution code