Alburnus sellal

Heckel, 1843 · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Alburnus

At a glance

Occurrence records394

Data sources9

Biological traits6

DNA specimens67

eDNA detections7

Sources9 archives

Databases and archives Alburnus sellal's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility305 records↗

OBISOcean Biodiversity Information System89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS394 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD67 specimens

01Narrative

The Sellal bleak (Alburnus sellal) is a species of ray-finned fish in the genus Alburnus. It can be found in the drainage basins of the Queiq River and the Tigris–Euphrates river system in Iran, Iraq, Syria and Turkey. A recent study has found that Alburnus mossulensis was probably a synonym of Alburnus sellal.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length26.2 cm

Body mass155 g

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability16.2

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alburnus sellal has left across the world's sequence archives.

At a glance

DNA specimens67

BINs2

Marker genes2

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P612 bp consensus64 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

257Cmostly conserved

260Gmostly conserved

281Amostly conserved

365Amostly conserved

413Gmostly conserved

428Cvariable

443Gmostly conserved

495Cmostly conserved

534Cmostly conserved

596Gmostly conserved

608Amostly conserved

CCTGAGCCGGAATAGTGGGGACTGCCCTAAGCCTCCTTATTCGAGCCGAACTAAGCCAACCCGGGTCACTTTTAGGCGATGATCAAATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes19

BINs2

Most divergent pair3.3%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alburnus kotschyisame genus4.2%Alburnus escherichiisame genus5.4%Alburnus nasreddinisame genus5.6%Alburnus filippiisame genus5.7%Alburnus alburnussame genus5.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PRho

animal barcodemarker

08Occurrence & distribution

Record type394 records

Museum / vouchered394

Range

Area of Occupancy AOO524 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 392 without coordinates

Open the institutions mapphysical evidence394

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	172
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	88
ZM-CBSUlocation not on record	13
FSJFlocation not on record	9
Frankfurt am Main	8
Cambridge, US	2
	2
Royal Museum for Central Africalocation not on record	1
FishBaselocation not on record	1

9 institutions · 296 of 394 vouchered records shown · 9 without an institution code

09Environmental DNA7 detections

Where the DNA of Alburnus sellal was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)