Alburnus mento

(Heckel, 1837) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Alburnus

At a glance

Occurrence records111

Data sources6

Biological traits4

DNA specimens35

eDNA detections0

Sources6 archives

Databases and archives Alburnus mento's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility111 records↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF111 records

DNA & barcodingBOLD35 specimens

01Narrative

Alburnus mento is a species of ray-finned fish in the genus Alburnus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length40 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability38.8

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alburnus mento has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

92Tmostly conserved

100Tmostly conserved

265Tmostly conserved

271Gmostly conserved

319Gmostly conserved

397Gvariable

589Tmostly conserved

CCTTTATCTTGTATTTGGTGCCTGAGCCGGGATAGTGGGGACTGCCCTAAGCCTCCTTATCCGGGCCGAACTAAGCCAGCCTGGGTCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes7

BIN1

Most divergent pair0.77%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alburnus doriaesame genus2.5%Alburnus escherichiisame genus2.9%Alburnus thessalicussame genus3.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type111 records

Wild obs. + sensor24

Museum / vouchered87

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 14≤1 km 3≤10 km 2>10 km 1

20 georeferenced · 4 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	63
SNSB-Zoologische Staatssammlung Münchenlocation not on record	5
ZSMlocation not on record	4
Helsinki, FI	4
	1
Frankfurt am Main	1

6 institutions · 78 of 87 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)