Alburnus leobergi — The Life Data

Animalia/Chordata/Cypriniformes/Cyprinidae/Alburnus

At a glance

Occurrence records187

Data sources7

Biological traits5

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Alburnus leobergi's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF187 records

DNA & barcodingBOLD3 specimens

01Narrative

Alburnus leobergi is a species of ray-finned fish in the genus Alburnus; it is widespread in Eastern Europe in the Sea of Azov basin. A landlocked population exists in Tsimlyansk Reservoir (Don drainage). It is a benthopelagic fish, up to 40.3 cm long.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length40.3 cm

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability30.3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alburnus leobergi has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.43%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

67Tvariable

232Tvariable

286Avariable

355Avariable

AGTGGGGACTGCCCTAAGCCTCCTTATCCGGGCCGAACTAAGCCAGCCTGGGTCACTCTTAGGTGATGATCAAATTTATAATGTCATCGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alburnus doriaesame genus2.3%Alburnus escherichiisame genus3.1%Alburnus thessalicussame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type187 records

Wild obs. + sensor165

Museum / vouchered22

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 125≤1 km 39

164 georeferenced · 1 without coordinates

Open the mapobservation + sensor165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	21

1 institutions · 21 of 22 vouchered records shown · 1 without an institution code