Alburnus derjugini

Berg, 1923 · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Alburnus

At a glance

Occurrence records111

Data sources8

Biological traits4

DNA specimens22

eDNA detections11

Sources8 archives

Databases and archives Alburnus derjugini's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility111 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF111 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD22 specimens

01Narrative

The Georgian shemaya (Alburnus derjugini) is a species of cyprinid fish in the genus Alburnus. It is found in eastern Black Sea tributaries, from south of the Caucasus in Russia and Georgia, south to the Çoruh River in eastern Anatolia, Turkey and west to the Sakarya River.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10.75 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alburnus derjugini has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

121Cmostly conserved

322Gmostly conserved

592Tmostly conserved

TACCCTTTATCTTGTATTTGGTGCCTGAGCCGGGATAGTGGGGACTGCCCTAAGCCTCCTTATCCGGGCCGAACTAAGCCAGCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes4

BIN1

Most divergent pair0.30%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alburnus doriaesame genus2.5%Alburnus escherichiisame genus2.9%Alburnus thessalicussame genus3.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type111 records

Wild obs. + sensor6

Museum / vouchered105

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 105 records without

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	92
Zoologisches Forschungsmuseum Alexander Koeniglocation not on record	1

2 institutions · 93 of 105 vouchered records shown · 12 without an institution code

09Environmental DNA11 detections

Where the DNA of Alburnus derjugini was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 23.8–23.8

Seasonal swing summer↔winter17.5 °C

Max temp (day)25.8 °C

Min temp (night)20.5 °C

Precipitation170 mm/mo

Air humidity66.0 %

Vapour deficit995 Pa

Cloud cover21.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)