Albula goreensis

Valenciennes, 1847 · species

image placeholder — illustration coming later

Animalia/Chordata/Albuliformes/Albulidae/Albula

At a glance

Occurrence records139

Data sources9

Biological traits3

DNA specimens88

eDNA detections97

Sources9 archives

Databases and archives Albula goreensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility109 records↗

OBISOcean Biodiversity Information System30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics88 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS139 records

Environmental DNA1 datasets · 7 countries97 detections

DNA & barcodingBOLD88 specimens

Genome at a glanceGoaT · NCBI≈934 Mbp

01Narrative

Albula goreensis est une espèce de poissons marins de la famille des Albulidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits1

Vulnerability44.26

05DNA & barcoding88 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Albula goreensis has left across the world's sequence archives.

At a glance

DNA specimens88

BINs1

Marker genes2

eDNA detections97

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus86 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

170Cmostly conserved

244Cmostly conserved

304Cmostly conserved

346Cmostly conserved

448Cvariable

496Cvariable

520Tmostly conserved

607Cmostly conserved

CCTCTATCTAGTGTTTGGCGCTTGAGCCGGAATGGTGGGTACAGCTTTGAGTCTTCTGATCCGGGCGGAGTTAAGTCAACCTGGGGCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes19

BIN1

Most divergent pair1.4%

OtherS.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Albula vulpessame genus8.9%Albula esunculasame genus9.0%Albula glossodontasame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Albula goreensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈933 663 665 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Albula goreensis0.93 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type139 records

Wild obs. + sensor62

Museum / vouchered77

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 61 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 77 records without

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Oceanic and Atmospheric Administrationlocation not on record	44
Tapachula, MX	23
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
University of Minnesota, James Ford Bell Museum of Natural Historylocation not on record	3
El Colegio de la Frontera Sur, Unidad Chetumallocation not on record	1

5 institutions · 75 of 77 vouchered records shown · 2 without an institution code

09Environmental DNA97 detections

Where the DNA of Albula goreensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.5–27.4

Seasonal swing summer↔winter2.70 °C

Max temp (day)25.4 °C 25.4–28.2

Min temp (night)24.2 °C 23.5–25.1

Precipitation45.5 mm/mo 45.5–154

Air humidity59.8 % 59.8–63.7

Moisture balance-143 mm/mo

Vapour deficit1,253 Pa 1,158–1,315

Wind speed5.70 m/s

Cloud cover25.9 % 23.5–31.2

CHELSA 1981–2010, ~9 km grid, at location & month of 92 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)