Alboglossiphonia heteroclita

(Linnaeus, 1761) · species

image placeholder — illustration coming later

Animalia/Annelida/Clitellata/Rhynchobdellida/Glossiphoniidae/Alboglossiphonia

At a glance

Occurrence records12 722

Data sources8

Biological traits0

DNA specimens75

eDNA detections16

Sources8 archives

Databases and archives Alboglossiphonia heteroclita's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 722 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF12 722 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD75 specimens

Genome at a glanceGoaT2n = 16

01Narrative

Alboglossiphonia heteroclita is een bloedzuiger die behoort tot de familie Glossiphoniidae. De soort heeft een kosmopolitische verspreiding.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alboglossiphonia heteroclita has left across the world's sequence archives.

At a glance

DNA specimens75

BINs11

Marker genes2

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 123 variable positions, in barcode order

18Tmostly conserved

22Tvariable

23Gmostly conserved

24Cmostly conserved

25Tmostly conserved

26Tmostly conserved

31Amostly conserved

37Amostly conserved

40Amostly conserved

46Amostly conserved

49Amostly conserved

52Avariable

60Tmostly conserved

67Amostly conserved

74Cvariable

91Tmostly conserved

98Amostly conserved

103Tmostly conserved

109Amostly conserved

110Tmostly conserved

118Cmostly conserved

121Cmostly conserved

130Amostly conserved

133Amostly conserved

136Cmostly conserved

140Cvariable

142Amostly conserved

160Amostly conserved

163Tmostly conserved

166Amostly conserved

169Tmostly conserved

172Tvariable

181Gvariable

184Gvariable

190Amostly conserved

193Tmostly conserved

202Tmostly conserved

205Amostly conserved

211Amostly conserved

214Avariable

217Tmostly conserved

220Cmostly conserved

232Cmostly conserved

235Tmostly conserved

238Amostly conserved

241Amostly conserved

244Tmostly conserved

247Cvariable

251Cmostly conserved

256Avariable

266Cmostly conserved

268Tmostly conserved

271Tvariable

277Tmostly conserved

278Tmostly conserved

284Cvariable

287Tmostly conserved

289Avariable

298Amostly conserved

307Avariable

313Amostly conserved

316Avariable

322Amostly conserved

325Cvariable

337Amostly conserved

343Tmostly conserved

346Amostly conserved

347Cmostly conserved

352Tmostly conserved

364Tmostly conserved

370Amostly conserved

373Cmostly conserved

376Tvariable

379Tmostly conserved

382Amostly conserved

385Tmostly conserved

391Amostly conserved

394Tvariable

397Tmostly conserved

401Tmostly conserved

415Amostly conserved

418Amostly conserved

428Tmostly conserved

433Tmostly conserved

448Cmostly conserved

451Cmostly conserved

454Amostly conserved

460Tvariable

469Cmostly conserved

478Amostly conserved

484Avariable

490Amostly conserved

493Tmostly conserved

494Tmostly conserved

500Tmostly conserved

508Gvariable

514Amostly conserved

526Amostly conserved

536Cmostly conserved

538Avariable

542Tmostly conserved

547Amostly conserved

548Cmostly conserved

550Tvariable

562Tvariable

565Avariable

568Avariable

581Cmostly conserved

586Amostly conserved

589Tmostly conserved

592Amostly conserved

604Cmostly conserved

622Amostly conserved

625Avariable

628Amostly conserved

631Avariable

637Amostly conserved

640Gmostly conserved

641Cmostly conserved

643Tmostly conserved

+3 more variable positions not shown

TACATTATATATAATTTTAGGTGCTTGAGCAGCTATAGTAGGTACAGCAATAAGAATTATTATTCGAATTGAACTAGCTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.2%

Haplotypes4

BINs7

Most divergent pair12.6%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alboglossiphonia pallidasame genus5.9%Alboglossiphonia papillosasame genus6.5%Alboglossiphonia hyalinasame genus7.9%Alboglossiphonia latasame genus9.3%Glossiphonia verrucatasame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Alboglossiphonia heteroclita carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type12 722 records

Wild obs. + sensor12 451

Museum / vouchered253

Cultivated / captive2

Other16

Range

Area of Occupancy AOO15 276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 11 634≤1 km 141≤10 km 311>10 km 2

12 088 georeferenced · 363 without coordinates

Open the mapobservation + sensor12 451

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 129≤1 km 27≤10 km 11>10 km 2

169 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence253

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	67
Helsinki, FI	56
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	11
DEMNA-DNElocation not on record	11
NTNU-VMlocation not on record	10
Toronto, CA	10
Stockholm, SE	6
BioFokuslocation not on record	6
Cambridge, US	5
Uniwersytet Śląski w Katowicachlocation not on record	3
Natural History Museum of Utahlocation not on record	1
State University of New York Buffalo State College, Great Lakes Centerlocation not on record	1
Saint John, CA	1
Frankfurt am Main	1

14 institutions · 189 of 253 vouchered records shown · 64 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA16 detections

Where the DNA of Alboglossiphonia heteroclita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

WetlandLake Nearshore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 20.2–22.5

Seasonal swing summer↔winter30.9 °C

Max temp (day)24.2 °C 24.2–26.3

Min temp (night)17.9 °C 17.9–19.6

Precipitation94.2 mm/mo 78.7–105

Air humidity59.1 % 58.0–59.2

Moisture balance-39.3 mm/mo -111–-39.3

Vapour deficit972 Pa 972–1,149

Wind speed3.00 m/s 2.90–5.50

Cloud cover39.3 % 37.4–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alboglossiphonia heteroclita

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type12 722 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type12 722 records