Albinaria terebra — The Life Data

Animalia/Mollusca/Gastropoda/Stylommatophora/Clausiliidae/Albinaria

At a glance

Occurrence records11

Data sources6

Biological traits0

DNA specimens3

eDNA detections0

Sources6 archives

Databases and archives Albinaria terebra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF11 records

DNA & barcodingBOLD3 specimens

01Narrative

Albinaria terebra is een slakkensoort uit de familie van de Clausiliidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door L. Pfeiffer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Albinaria terebra has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BIN1

Most divergent pair1.7%

Where individuals differ — all 11 variable positions, in barcode order

13Avariable

31Cvariable

55Cvariable

56Tvariable

67Avariable

199Avariable

202Cvariable

412Tvariable

562Tvariable

565Avariable

643Cvariable

TACCTTATATATATTATTTGGTATTTGATGCGGAATAGTCGGAACAGGGTTATCCTTATTAATCCGATTAGAGTTGGGGACATCTGGTAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Albinaria idaeasame genus12.2%Albinaria corrugatasame genus13.4%Albinaria teressame genus13.4%Albinaria arthurianasame genus13.9%Albinaria candidasame genus14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type11 records

Museum / vouchered11

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2>10 km 2

4 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence11

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	6
Cambridge, US	2
Salzburg, AT	1
Denver, US	1
Provincia di Livornolocation not on record	1

5 institutions · 11 of 11 vouchered records shown