Albatrellus citrinus

Ryman · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Russulales/Albatrellaceae/Albatrellus

At a glance

Occurrence records1 547

Data sources8

Biological traits0

DNA specimens14

eDNA detections15

Sources8 archives

Databases and archives Albatrellus citrinus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 547 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 547 records

Environmental DNA2 datasets · 1 countries15 detections

DNA & barcodingBOLD · NCBI14 specimens

01Narrative

Albatrellus citrinus is a species of fungus in the family Albatrellaceae. Found in Europe, it was described as new to science by Svengunnar Ryman and colleagues in 2003.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Albatrellus citrinus has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes1

GenBank sequences10

eDNA detections15

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAY198195.1 ↗654 bp

ACGT

TCCGTAGGTGAACCTGCGGAAGGATCATTAACGAAAGCTCGAGTGAGGTTGTGGCTGGTCCCTCCCGGGGGGCAACGTGCACGCCTCGTC …

Albatrellus citrinus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type1 547 records

Wild obs. + sensor1 364

Museum / vouchered183

Range

Area of Occupancy AOO2 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 070≤1 km 119≤10 km 57>10 km 6

1 252 georeferenced · 112 without coordinates

Open the mapobservation + sensor1 364

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 72≤1 km 17≤10 km 14>10 km 10

113 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence183

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	50
SLU Artdatabankenlocation not on record	26
Helsinki, FI	20
Uppsala, SE	16
Philadelphia, US	13
Tartu, EE	7
nsnflocation not on record	6
Universidade de Lisboa, Museu Bocagelocation not on record	6
University of Oslo, Natural History Museumlocation not on record	4
Göteborg, SE	3
WU-MYClocation not on record	3
TUR-Alocation not on record	2
BDBClocation not on record	2
Stockholm, SE	2
BioFokuslocation not on record	2
Turku, FI	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Lausanne, CH	1
LDlocation not on record	1
Karlsruhe, DE	1
Copenhagen, DK	1

21 institutions · 168 of 183 vouchered records shown · 15 without an institution code

09Environmental DNA15 detections

Where the DNA of Albatrellus citrinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

Gran, kalkrikt, med ogsa furu

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 12.0–12.9

Seasonal swing summer↔winter19.1 °C

Max temp (day)15.2 °C 14.9–15.2

Min temp (night)9.80 °C 9.00–10.2

Precipitation90.6 mm/mo 87.3–105

Air humidity62.1 % 61.7–62.7

Moisture balance34.8 mm/mo 19.3–53.8

Vapour deficit549 Pa 526–569

Wind speed3.60 m/s 2.30–3.80

Cloud cover43.2 % 43.1–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Albatrellus citrinus

At a glance

Sources8 archives

At a glance

Record type1 547 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 547 records