Albatrellus avellaneus

Pouzar · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Russulales/Albatrellaceae/Albatrellus

At a glance

Occurrence records147

Data sources9

Biological traits0

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Albatrellus avellaneus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility147 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF147 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Albatrellus avellaneus is a species of fungus in the family Albatrellaceae. Found in the United States and Canada, it was described by Czech mycologist Zdeněk Pouzar in 1972. It is associated with conifers such as western hemlock and spruce. Sometimes multiple fruit bodies grow into one merged form. The cap is buff, occasionally with reddish tones; yellow hues become stronger with age, when scales also emerge. The tubes are white, staining yellowish with age. The stem is buff above and brownish below. Dried mushrooms tend to take on orangish hues. Similar species include Albatrellus ovinus and A. subrubescens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Albatrellus avellaneus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ271319.1 ↗308 bpUSA · 1956

ACGT

GAACGCACCTTGCGCCTCTTGGTATTCCGAGGGGCACGCCTGTTTGAGTATCGTGAAATCGTCAACCCGATCCCTTTCGTGAAAACGAAG …

Albatrellus avellaneus isolate MICH CIB A. H. Smith 56474 voucher MICH:153950 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type147 records

Wild obs. + sensor125

Museum / vouchered22

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 47≤1 km 17≤10 km 20>10 km 23

107 georeferenced · 18 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 1≤10 km 12>10 km 1

14 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	12
Vancouver, CA	6
Chicago, US	1
Denver, US	1
Ann Arbor, US	1
Universidade de Lisboa, Museu Bocagelocation not on record	1

6 institutions · 22 of 22 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Albatrellus avellaneus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)