Albara reversaria

Walker, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Drepanidae/Albara

At a glance

Occurrence records61

Data sources7

Biological traits0

DNA specimens9

eDNA detections4

Sources7 archives

Databases and archives Albara reversaria's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF61 records

Environmental DNA1 datasets · 3 countries4 detections

DNA & barcodingBOLD9 specimens

01Narrative

Albara reversaria is a moth of the family Drepanidae. It was described by Francis Walker in 1866. It is found in Sumatra, Borneo, Peninsular Malaysia, the north-eastern parts of the Himalaya and Taiwan. The larvae feed on Myrica species, as well as the leaves of Quercus variabilis. Mature larvae fix their body to the base of a leaf with silk and curve the leaf margins where pupation takes place.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Albara reversaria has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections4

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)3.0%

Haplotypes2

BINs3

Most divergent pair1.4%

Where individuals differ — all 46 variable positions, in barcode order

25Tmostly conserved

46Tmostly conserved

67Gvariable

74Tmostly conserved

82Tmostly conserved

92Tmostly conserved

100Amostly conserved

106Cvariable

115Tvariable

133Tmostly conserved

169Tmostly conserved

172Tmostly conserved

197Tvariable

202Amostly conserved

205Cvariable

211Amostly conserved

212Tmostly conserved

217Avariable

220Cvariable

238Tvariable

266Cvariable

278Tvariable

286Tvariable

313Tvariable

322Tmostly conserved

358Tmostly conserved

364Cvariable

376Cvariable

400Tvariable

401Tvariable

424Avariable

428Cmostly conserved

430Amostly conserved

433Amostly conserved

478Tmostly conserved

490Cvariable

523Tmostly conserved

532Cvariable

533Cmostly conserved

544Tvariable

556Amostly conserved

559Amostly conserved

574Cvariable

586Amostly conserved

610Tvariable

646Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGGGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Albara hollowayisame genus5.5%Mosopia pallidusalissame order7.1%Mosopia eudoxusalissame order7.3%Protodeltote albidulasame order7.9%Peteroma albilineasame order8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor60

Museum / vouchered1

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 14≤1 km 29≤10 km 4>10 km 1

48 georeferenced · 12 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Centre for Biodiversity Genomicslocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Albara reversaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 22.4–25.4

Seasonal swing summer↔winter1.20 °C

Max temp (day)28.5 °C 25.4–29.2

Min temp (night)21.1 °C 18.3–22.0

Precipitation231 mm/mo 198–518

Air humidity69.2 % 67.6–71.2

Moisture balance101 mm/mo 62.9–382

Vapour deficit991 Pa 795–1,024

Wind speed1.40 m/s 1.00–1.50

Cloud cover65.8 % 59.8–68.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)