Alauda razae

(Alexander, 1898) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Alaudidae/Alauda

At a glance

Occurrence records221

Data sources8

Biological traits25

DNA specimens7

eDNA detections1

Sources8 archives

Databases and archives Alauda razae's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility221 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF221 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

The Raso lark (Alauda razae) is a small passerine bird with a highly restricted range, being found only on Raso islet in the Cape Verde Islands. This critically endangered member of the family Alaudidae lives in very arid terrain, and is considered one of the least known birds in the Western Palaearctic region, due to its remoteness and the lack of much ornithological study on the archipelago as a whole.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth5.2 mm

Beak length (culmen)15.7 mm

Beak length (nares)10.5 mm

Beak width4.5 mm

Body mass22 g

Body mass (female)20 g

Body mass (male)24 g

Hand-wing index21.1

Kipp's distance16.7 mm

Secondary length62.4 mm

Tail length46.7 mm

Tarsus length20.9 mm

Wing length79.9 mm

Life cycle & reproduction1

Litter size3

Diet & foraging7

Ground100 %

Invertebrate50 %

Plant other10 %

Seed30 %

Trophic levelomnivore

Trophic nicheOmnivore

Vertebrate ectotherm10 %

Habitat & environment4

HabitatShrubland

Migration1.0

Primary lifestyleTerrestrial

Range size1.92 km²

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alauda razae has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

eDNA detections1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P663 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.34%

Haplotypes2

BINs0

Most divergent pair1.2%

Where individuals differ — all 8 variable positions, in barcode order

26Gmostly conserved

276Cmostly conserved

282Amostly conserved

321Gmostly conserved

328Gmostly conserved

375Tmostly conserved

402Cmostly conserved

408Tmostly conserved

GGTACTGCCCTAAGCCTTCTCATCCGAGCAGAACTGGGCCAACCCGGCGCTCTGCTAGGAGACGACCAAATTTATAACGTAGTCGTTACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alauda arvensissame genus4.2%Alauda gulgulasame genus7.2%Galerida cristatasame family9.1%Melanocorypha mongolicasame family9.7%Eremophila alpestrissame family10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type221 records

Wild obs. + sensor208

Museum / vouchered13

Origin

Native1

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 70≤1 km 3>10 km 5

78 georeferenced · 130 without coordinates

Open the mapobservation + sensor208

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 13

13 georeferenced

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	12
Ann Arbor, US	1

2 institutions · 13 of 13 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Alauda razae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)