Alatuncusia bergii

Möschler, 1889 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Alatuncusia

At a glance

Occurrence records28

Data sources7

Biological traits0

DNA specimens15

eDNA detections7

Sources7 archives

Databases and archives Alatuncusia bergii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD15 specimens

01Narrative

Alatuncusia bergii, or Berg's alatuncusia moth, is a moth in the family Crambidae. It was described by Heinrich Benno Möschler in 1890. It is found in the West Indies (including Puerto Rico Cuba and Jamaica), from Mexico to Venezuela and in southern Florida. The wingspan is 22 mm. Adults are on wing from July to December in Florida. The larvae feed on Capparis cynophallophora."Species Alatuncusia bergii - Berg's Alatuncusia Moth - Hodges#4793". BugGuide. Retrieved January 6, 2018.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alatuncusia bergii has left across the world's sequence archives.

At a glance

DNA specimens15

BINs2

Marker genes1

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

82Cvariable

85Cvariable

106Tmostly conserved

197Tvariable

217Tmostly conserved

274Gvariable

325Tvariable

328Amostly conserved

340Tmostly conserved

367Cvariable

368Gmostly conserved

379Amostly conserved

385Cvariable

391Amostly conserved

421Cvariable

428Cvariable

430Tvariable

433Amostly conserved

442Cvariable

451Tvariable

463Tvariable

466Avariable

469Amostly conserved

478Tvariable

479Tvariable

500Tvariable

514Tvariable

532Cvariable

533Tvariable

536Cvariable

538Tvariable

539Tvariable

541Avariable

562Gmostly conserved

574Tvariable

610Tvariable

619Tvariable

628Amostly conserved

631Ahighly variable

640Tvariable

TACATTATACTTCATATTTGGTATTTGAGCAGGTATAGTAGGAACATCATTAAGTTTATTAATTCGAGCTGAATTAGGTAACCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes9

BINs2

Most divergent pair5.3%

N.AmericaOtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aristotelia bifasciellasame order8.7%Pycnarmon cribratasame family8.8%Exoteleia pinifoliellasame order9.1%Lochmaeus manteosame order9.3%Pygospila tyressame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type28 records

Wild obs. + sensor4

Museum / vouchered24

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 1>10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 24 records without

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
National Biodiversity Institute, Costa Ricalocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2

4 institutions · 22 of 24 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Alatuncusia bergii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 24.3–27.5

Seasonal swing summer↔winter3.20 °C

Max temp (day)28.9 °C 26.0–30.0

Min temp (night)24.1 °C 22.3–26.2

Precipitation92.6 mm/mo 56.0–227

Air humidity62.7 % 61.5–65.9

Moisture balance138 mm/mo

Vapour deficit1,337 Pa 1,101–1,388

Wind speed5.70 m/s

Cloud cover32.3 % 24.0–33.5

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)