Alatina alata

(Reynaud, 1830) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Cubozoa/Carybdeida/Alatinidae/Alatina

At a glance

Occurrence records205

Data sources11

Biological traits5

DNA specimens65

eDNA detections58

Sources11 archives

Databases and archives Alatina alata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility161 records↗

OBISOcean Biodiversity Information System44 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics65 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS205 records

Environmental DNA1 datasets · 4 countries58 detections

DNA & barcodingBOLD65 specimens

Genome at a glanceGoaT · NCBI≈1.3 Gbp

01Narrative

Alatina alata (Reynaud, 1830), often called a sea wasp, is a species of box jellyfish found in the Pacific, Indian and Atlantic Oceans and in the Caribbean and Arabian Sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max2 282 m

Depth min55 m

05DNA & barcoding65 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alatina alata has left across the world's sequence archives.

At a glance

DNA specimens65

BINs5

Marker genes12

eDNA detections58

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P558 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

4Tmostly conserved

15Cmostly conserved

42Tmostly conserved

66Tmostly conserved

105Gmostly conserved

115Tvariable

126Gmostly conserved

144Tmostly conserved

174Cmostly conserved

180Tmostly conserved

192Cmostly conserved

211Cmostly conserved

234Gmostly conserved

237Amostly conserved

240Gmostly conserved

246Tmostly conserved

255Cvariable

258Tmostly conserved

264Cmostly conserved

267Tmostly conserved

288Tmostly conserved

291Avariable

324Gmostly conserved

327Tmostly conserved

351Tvariable

369Gmostly conserved

393Tmostly conserved

420Amostly conserved

456Tmostly conserved

487Cmostly conserved

516Gmostly conserved

540Tvariable

543Tmostly conserved

550Tmostly conserved

555Cmostly conserved

ATGTTGGGGGATGACCAACTTTATAATGTTATTGTTACTGCTCATGCTTTTGTAATGATATTTTTTTTGGTAATGCCTGTTATGATAGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes38

BINs5

Most divergent pair4.5%

N.AmericaOceaniaOtherEurope

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5PCOIICOXIIIND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcoderibosomalmitochondrial

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alatina alata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 308 494 669 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alatina alata1.31 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type205 records

Wild obs. + sensor42

Museum / vouchered163

Range

Area of Occupancy AOO376 km²

Depth

0–200 m sunlit9

200–1000 m twilight5

1–4 km midnight1

>4 km abyssal0

median 90 m · max 1 800 m · 15 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 19≤1 km 7≤10 km 5>10 km 1

32 georeferenced · 10 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 3≤10 km 3>10 km 3

10 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence163

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	50
Copenhagen, DK	6
ECO-CH-Zlocation not on record	4
University of California San Diegolocation not on record	3
	2
Western Australian Museumlocation not on record	2
New Haven, US	1
Natick, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Sydney, AU	1

10 institutions · 71 of 163 vouchered records shown · 46 without an institution code

09Environmental DNA58 detections

Where the DNA of Alatina alata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 24.5–27.0

Seasonal swing summer↔winter3.30 °C

Max temp (day)26.4 °C 25.6–27.5

Min temp (night)25.3 °C 23.7–26.2

Precipitation93.9 mm/mo 44.5–168

Air humidity61.7 % 59.0–64.2

Moisture balance-68.8 mm/mo

Vapour deficit1,255 Pa 1,240–1,295

Wind speed6.80 m/s

Cloud cover36.1 % 22.7–68.4

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)