Alastor atropos

Lepeletier, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Eumenidae/Alastor

At a glance

Occurrence records199

Data sources7

Biological traits0

DNA specimens6

eDNA detections4

Sources7 archives

Databases and archives Alastor atropos's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF199 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD6 specimens

01Narrative

Alastor atropos is a species of wasp in the family Vespidae.Alastor at www.biolib.cz.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alastor atropos has left across the world's sequence archives.

At a glance

DNA specimens6

BINs3

Marker genes1

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Diversity (π)7.7%

Haplotypes2

BINs3

Most divergent pair0.46%

Where individuals differ — all 113 variable positions, in barcode order

2Tvariable

25Amostly conserved

34Avariable

47Amostly conserved

91Amostly conserved

112Tmostly conserved

151Cvariable

160Tmostly conserved

184Tmostly conserved

187Tvariable

190Tmostly conserved

194Tmostly conserved

211Tvariable

217Tmostly conserved

244Tmostly conserved

268Cvariable

283Tmostly conserved

287Avariable

295Amostly conserved

304Cvariable

307Avariable

309Cmostly conserved

319Gvariable

332Cvariable

340Tmostly conserved

346Tmostly conserved

349Cmostly conserved

355Amostly conserved

361Amostly conserved

366Amostly conserved

367Tmostly conserved

383Tvariable

415Cvariable

430Amostly conserved

436Tmostly conserved

439Cvariable

442Cvariable

479Amostly conserved

489Amostly conserved

496Amostly conserved

508Amostly conserved

512Gmostly conserved

514Amostly conserved

535Tmostly conserved

536Tmostly conserved

538Avariable

539Cmostly conserved

541Tvariable

542Tmostly conserved

543Cmostly conserved

546Tmostly conserved

548Cmostly conserved

549Cmostly conserved

550Tmostly conserved

551Gmostly conserved

552Tmostly conserved

554Cmostly conserved

556Tmostly conserved

557Gmostly conserved

558Cmostly conserved

559Tmostly conserved

561Gmostly conserved

562Amostly conserved

564Cmostly conserved

566Amostly conserved

567Tmostly conserved

568Tmostly conserved

570Cmostly conserved

573Tmostly conserved

574Amostly conserved

575Tmostly conserved

578Amostly conserved

580Tmostly conserved

581Tmostly conserved

582Cmostly conserved

584Gmostly conserved

585Amostly conserved

587Cmostly conserved

588Gmostly conserved

589Amostly conserved

590Amostly conserved

591Amostly conserved

592Cmostly conserved

593Tmostly conserved

594Tmostly conserved

595Amostly conserved

596Amostly conserved

597Amostly conserved

598Tmostly conserved

599Tmostly conserved

600Cmostly conserved

604Amostly conserved

606Tmostly conserved

607Tmostly conserved

611Gmostly conserved

612Amostly conserved

614Cmostly conserved

615Cmostly conserved

616Cmostly conserved

617Tmostly conserved

620Gmostly conserved

621Gmostly conserved

628Avariable

630Amostly conserved

631Tmostly conserved

632Cmostly conserved

633Cmostly conserved

634Tvariable

635Amostly conserved

636Tmostly conserved

638Tmostly conserved

640Amostly conserved

649Cvariable

ATTATATTTTTTATTTGGTATATGATCAGGAATAATTGGATCAAGAATAAGTATAATTATTCGATTAGAATTAAGATCTCCTGGAAGATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euodynerus apicalissame family16.1%Euodynerus danticisame family16.4%Euodynerus annulatussame family16.5%Euodynerus crypticussame family17.1%Dolichovespula adulterinasame family17.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type199 records

Wild obs. + sensor71

Museum / vouchered128

Origin

Native12

Range

Area of Occupancy AOO376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 12≤1 km 9≤10 km 13

34 georeferenced · 37 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤1 km 16≤10 km 33>10 km 4

53 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	63
Provincia di Livornolocation not on record	17
Geneva, CH	14
Zürich, CH	10
UGRlocation not on record	6
ZSMlocation not on record	3
Tilburg, NL	3
NMOKlocation not on record	3
Bern, CH	2
Philadelphia, US	1
Bavarian State Collection of Zoologylocation not on record	1

11 institutions · 123 of 128 vouchered records shown · 5 without an institution code

09Environmental DNA4 detections

Where the DNA of Alastor atropos was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Olive orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 17.5–19.6

Seasonal swing summer↔winter18.4 °C

Max temp (day)23.8 °C 21.7–23.8

Min temp (night)14.2 °C 12.1–14.2

Precipitation123 mm/mo 71.6–123

Air humidity57.4 % 56.7–57.4

Moisture balance-13.3 mm/mo -65.9–-13.3

Vapour deficit975 Pa 866–975

Wind speed2.50 m/s 2.50–2.90

Cloud cover34.2 % 34.2–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)