Alarodia slossoniae

Packard, 1893 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Limacodidae/Alarodia

At a glance

Occurrence records141

Data sources5

Biological traits0

DNA specimens14

eDNA detections11

Sources5 archives

Databases and archives Alarodia slossoniae's data was compiled from.

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF141 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD14 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alarodia slossoniae has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes2

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

76Amostly conserved

160Avariable

181Avariable

206Cmostly conserved

271Cmostly conserved

295Avariable

328Tvariable

367Cvariable

379Amostly conserved

391Avariable

400Avariable

403Amostly conserved

424Avariable

433Avariable

476Gmostly conserved

526Amostly conserved

548Cmostly conserved

565Gvariable

628Amostly conserved

637Amostly conserved

643Amostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAATTGGAACATCACTAAGTTTATTAATTCGAGCAGAATTAGGTAACCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes6

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anurapteryx interlineatasame order11.7%Pagyda salvalissame order12.6%Prasinocyma dorsipunctatasame order12.8%Eupoecilia wegnerisame order12.8%Perola villosipessame family12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type141 records

Wild obs. + sensor124

Museum / vouchered17

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 67≤1 km 20≤10 km 11>10 km 4

102 georeferenced · 22 without coordinates

Open the mapobservation + sensor124

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	11
Mississippi State, US	2
New Haven, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

5 institutions · 16 of 17 vouchered records shown · 1 without an institution code

09Environmental DNA11 detections

Where the DNA of Alarodia slossoniae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

PinelandTransition forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 19.2–25.7

Seasonal swing summer↔winter6.90 °C

Max temp (day)25.2 °C 22.3–26.4

Min temp (night)20.1 °C 15.8–25.0

Precipitation55.9 mm/mo 48.8–80.1

Air humidity60.4 % 58.7–60.8

Moisture balance-84.1 mm/mo -132–-53.0

Vapour deficit1,026 Pa 911–1,287

Wind speed4.90 m/s 2.90–5.40

Cloud cover34.1 % 25.7–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)