Alaena nyassa

Hewitson, 1877 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Alaena

At a glance

Occurrence records35

Data sources6

Biological traits0

DNA specimens3

eDNA detections0

Sources6 archives

Databases and archives Alaena nyassa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF35 records

DNA & barcodingBOLD3 specimens

01Narrative

Alaena nyassa, the pied Zulu, is a butterfly in the family Lycaenidae. It is found in the Democratic Republic of the Congo, Tanzania, Malawi, Zambia, Mozambique and Zimbabwe. The habitat consists of riverine woodland, grassy places in savanna regions, montane grassland with rocky outcrops, forest margins, heavy woodland and rocky streams. Adults have been recorded nearly year round, except June and July. The larvae feed on cyanobacteria growing on rocks.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alaena nyassa has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

181Gvariable

AACTTTATATTTTATTTTTGGTATTTGAGCGGGAATAGTGGGAACTTCTTTAAGAATTTTAATTCGAATAGAATTGGGAACCCCAAATTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ministrymon phrutussame family8.8%Ussuriana michaelissame family9.0%Strephonota tephraeussame family9.0%Calycopis calussame family9.1%Arzecla tucumanensissame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type35 records

Wild obs. + sensor24

Museum / vouchered11

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 10≤1 km 6≤10 km 2

18 georeferenced · 6 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 4

6 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	5
New Haven, US	3
Cambridge, US	3

3 institutions · 11 of 11 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)