Alaena brainei — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Alaena

At a glance

Occurrence records10

Data sources7

Biological traits0

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Alaena brainei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 records

DNA & barcodingBOLD3 specimens

01Narrative

Alaena brainei, the Braine's Zulu, is a butterfly in the family Lycaenidae. It is found in north-central Namibia. The habitat consists of rocky grassland. Adults are on wing from November to the beginning of May. Larvae feed on algae (Cyanobacteria) growing on rocks.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alaena brainei has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

313Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCATTAAGAATCTTAATCCGAATAGAATTAGGAACAACAAACTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ministrymon phrutussame family9.0%Durbaniella clarkisame family9.0%Rhamma shapiroisame family9.3%Nacaduba biocellatasame family9.3%Anthene paraffinissame family9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type10 records

Museum / vouchered10

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

10Collections & institutions

Institution	Specimens
National Museums of Kenyalocation not on record	10

1 institutions · 10 of 10 vouchered records shown