Alabes dorsalis

(Richardson, 1845) · species

image placeholder — illustration coming later

Animalia/Chordata/Gobiesociformes/Gobiesocidae/Alabes

At a glance

Occurrence records1 177

Data sources8

Biological traits6

DNA specimens5

eDNA detections4

Sources8 archives

Databases and archives Alabes dorsalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility478 records↗

OBISOcean Biodiversity Information System699 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 177 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

The common shore eel (Alabes dorsalis) is a species of clingfish from Australia. It is generally found in the south-eastern waters of Australia. It usually grows to about 12 cms (4.7 in). Often found by beachgoers after looking in rock-pools and turning over shells. A little pied cormorant with a common shore eel, Alabes dorsalis, at the Bellerive waterfront, Derwent River, Tasmania

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length12 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max10 m

Depth min0 m

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alabes dorsalis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.76%

Haplotypes1

BIN1

Where individuals differ — all 10 variable positions, in barcode order

104Cmostly conserved

113Tmostly conserved

185Cmostly conserved

197Gmostly conserved

317Tmostly conserved

347Amostly conserved

419Tmostly conserved

449Cmostly conserved

471Cmostly conserved

602Cmostly conserved

GCACCCTTTACCTGGTCTTTGGTGCTTGAGCGGGGATAATCGGCACAGCTTTAAGTCTAATTATTCGGGCTGAGCTTAGTCAGCCCGGGT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 177 records

Wild obs. + sensor101

Museum / vouchered1 076

Origin

Native3

Range

Area of Occupancy AOO1 160 km²

Depth

0–200 m sunlit39

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.4 m · max 164.5 m · 39 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 50≤1 km 20≤10 km 9

79 georeferenced · 22 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 19≤1 km 213≤10 km 249>10 km 21

502 georeferenced · 574 without coordinates

Open the institutions mapphysical evidence1 076

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	111
Sydney, AU	82
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	62
QVMAGlocation not on record	37
Australian National Fish Collectionlocation not on record	32
Tasmanian Museum & Art Gallerylocation not on record	30
Western Australian Museumlocation not on record	9
Natick, US	4
Texas Cooperative Wildlife Collectionlocation not on record	3
	2
New Haven, US	1
Paris, FR	1
FishBaselocation not on record	1
CASlocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1
South Kensington, GB	1
Toronto, CA	1

17 institutions · 379 of 1 076 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Alabes dorsalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 12.1–12.1

Seasonal swing summer↔winter5.80 °C

Max temp (day)13.6 °C

Min temp (night)10.6 °C

Precipitation76.4 mm/mo

Air humidity61.0 %

Moisture balance20.4 mm/mo

Vapour deficit549 Pa

Wind speed3.70 m/s

Cloud cover39.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alabes dorsalis

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Record type1 177 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 177 records