Alabagrus texanus

(Cresson, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Alabagrus

At a glance

Occurrence records192

Data sources7

Biological traits0

DNA specimens16

eDNA detections16

Sources7 archives

Databases and archives Alabagrus texanus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility192 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF192 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Alabagrus texanus is a species of braconid wasp in the family Braconidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alabagrus texanus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes2

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)0.88%

Haplotypes0

BINs2

Where individuals differ — all 35 variable positions, in barcode order

1Amostly conserved

2Tmostly conserved

3Amostly conserved

5Tmostly conserved

6Amostly conserved

7Tmostly conserved

8Amostly conserved

12Tmostly conserved

81Tmostly conserved

84Tmostly conserved

99Tmostly conserved

119Gmostly conserved

127Nhighly variable

189Amostly conserved

199Gmostly conserved

234Cmostly conserved

285Amostly conserved

297Amostly conserved

324Tmostly conserved

342Tmostly conserved

368Gmostly conserved

387Amostly conserved

420Tmostly conserved

429Gmostly conserved

498Amostly conserved

525Amostly conserved

526Gmostly conserved

528Amostly conserved

529Amostly conserved

530Tmostly conserved

538Tmostly conserved

539Tmostly conserved

564Amostly conserved

594Tmostly conserved

624Amostly conserved

ATATTATATTTTATTTTTGGAATTTGATCAGGAATTTTTGGTTTATCATTAAGTTTAATTATTCGTATAGAATTAAGAGTTGGTGGTAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alabagrus jeanfrancoislandryisame genus4.6%Alabagrus combossame genus5.1%Alabagrus arawaksame genus6.5%Alabagrus imitatussame genus6.6%Alabagrus jeanmariecadiouisame genus6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S

animal barcodemarker

08Occurrence & distribution

Record type192 records

Wild obs. + sensor30

Museum / vouchered162

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 16≤1 km 8>10 km 2

26 georeferenced · 4 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 4≤1 km 2≤10 km 13>10 km 4

23 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Central Floridalocation not on record	80
UKY-HIClocation not on record	54
Wuzhou, CN	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Champaign, US	2
Facultad de Ingeniería y Ciencias, Universidad Autónoma de Tamaulipaslocation not on record	2
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	2
CUlocation not on record	1
Research Collection of Michael Sharkeylocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Chicago, US	1

11 institutions · 149 of 162 vouchered records shown · 11 without an institution code

09Environmental DNA16 detections

Where the DNA of Alabagrus texanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 20.9–25.5

Seasonal swing summer↔winter24.2 °C

Max temp (day)27.6 °C 26.4–31.0

Min temp (night)17.4 °C 16.0–21.0

Precipitation101 mm/mo 72.9–116

Air humidity57.6 % 55.8–58.6

Moisture balance-49.4 mm/mo -80.0–-33.0

Vapour deficit1,146 Pa 1,047–1,382

Wind speed2.80 m/s 2.30–3.50

Cloud cover31.2 % 29.0–36.8

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)