Akephorus obesus

(LeConte, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Akephorus

At a glance

Occurrence records39

Data sources8

Biological traits0

DNA specimens18

eDNA detections15

Sources8 archives

Databases and archives Akephorus obesus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF39 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD18 specimens

01Narrative

Akephorus obesus is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Akephorus obesus has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

292Gvariable

337Amostly conserved

430Gvariable

562Amostly conserved

AACTCTGTATTTTATTTTTGGAATCTGATCAGGAATAGTTGGAACTTCATTAAGAATTCTTATTCGAACAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Akephorus marinussame genus3.8%Dyschirius interiorsame family8.7%Dyschirius varidenssame family9.1%Dyschirius thoracicussame family10.0%Dyschirius obscurussame family10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type39 records

Wild obs. + sensor10

Museum / vouchered29

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 1

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 17

17 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Alabamalocation not on record	17
OSUClocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Santa Barbara Museum of Natural Historylocation not on record	1
Royal British Columbia Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

6 institutions · 27 of 29 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Akephorus obesus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

Bog forest, Zonal ForestBog Forest, Cedar-Salal Forest, Zonal Forestintertidal sandSandy beachBeachBog Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 12.2–14.6

Seasonal swing summer↔winter10.3 °C

Max temp (day)14.7 °C 14.7–18.5

Min temp (night)10.1 °C 10.1–12.9

Precipitation158 mm/mo 93.9–158

Air humidity66.2 % 66.2–67.7

Moisture balance43.4 mm/mo -26.3–43.4

Vapour deficit482 Pa 482–538

Wind speed4.50 m/s 1.50–4.50

Cloud cover38.7 % 37.6–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)