Ajuga turkestanica

(Regel) Briq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Ajuga

At a glance

Occurrence records32

Data sources6

Biological traits15

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Ajuga turkestanica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Chemical compositionLOTUS15 compounds

Occurrence & distributionGBIF32 records

DNA & barcodingNCBIsequences

01Narrative

Ajuga turkestanica is a herbaceous flowering plant native to Central Asia. It was first described in 1894.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max0.5 m

Plant height min0.4 m

Life cycle & reproduction5

Flowering endJul

Flowering startApr

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max2 500 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTmountains, stony places

Woodinesswoody

03Chemical composition15 compounds

Compounds documented for Ajuga turkestanica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Ecdysteroids10

Iridoids monoterpenoids3

Ecdysteroids $ Ergostane steroids2

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,5R,10R,13R)-2,3,14-trihydroxy-10,13-dimethyl-17-[(2R)-2,3,6-trihydroxy-6-methylheptan-2-yl]-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one	present	LOTUS
(2S,3R,5R,9R,10R,11R,13R,14R,17S)-2,3,11,14-tetrahydroxy-10,13-dimethyl-17-[(2R,3R)-2,3,6-trihydroxy-6-methylheptan-2-yl]-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one	present	LOTUS
(2S,3R,5R,9R,10R,13R,14S,17S)-17-[5-ethyl-2,3-dihydroxy-6-(hydroxymethyl)hept-6-en-2-yl]-2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one	present	LOTUS
17-[1-(4-Ethyl-5-methyl-6-oxo-2,3-dihydropyran-2-yl)-1-hydroxyethyl]-2,3,14-trihydroxy-10,13-dimethyl-1,2,3,4,5,9,11,15,16,17-decahydrocyclopenta[a]phenanthrene-6,12-dione	present	LOTUS
2,3,11,14-tetrahydroxy-10,13-dimethyl-17-(2,3,6-trihydroxy-6-methylheptan-2-yl)-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one	present	LOTUS
20-Hydroxyecdysone	present	LOTUS
4-[2,3-dihydroxy-3-(2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl)butyl]-3,5-dimethyloxolan-2-one	present	LOTUS
[(1S,4aS,5R,7S,7aS)-4a,5-dihydroxy-7-methyl-1-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-7-yl] acetate	present	LOTUS
[(2R,3R)-1-[(2R,3S,4S)-2,4-dimethyl-5-oxooxolan-3-yl]-3-hydroxy-3-[(2S,3R,5R,9R,10R,13R,14S,17S)-2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]butan-2-yl] acetate	present	LOTUS
[(4aS,7S,7aR)-4a,5-dihydroxy-7-methyl-1-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-7-yl] acetate	present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ajuga turkestanica has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ452655.1 ↗683 bpUzbekistan · 2026

ACGT

CCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCTGCAAAGCAGACCGCGAACACGTGTTTAACCATATCGGGACCGACGGCCCCGG …

Ajuga turkestanica cultivar Var2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type32 records

Wild obs. + sensor14

Museum / vouchered18

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 13

13 georeferenced · 1 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Academy of Sciences of the Republic of Uzbekistanlocation not on record	11
Moscow State Universitylocation not on record	6

2 institutions · 17 of 18 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)