Aizobius sedi

(Germar, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Apionidae/Aizobius

At a glance

Occurrence records305

Data sources6

Biological traits2

DNA specimens13

eDNA detections11

Sources6 archives

Databases and archives Aizobius sedi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility305 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF305 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD13 specimens

01Narrative

Aizobius sedi é uma espécie de insetos coleópteros polífagos pertencente à família Apionidae. A autoridade científica da espécie é Germar, tendo sido descrita no ano de 1818. Trata-se de uma espécie presente no território português.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aizobius sedi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs3

Marker genes2

eDNA detections11

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

1Amostly conserved

35Amostly conserved

40Gmostly conserved

58Tmostly conserved

76Amostly conserved

82Cmostly conserved

85Gvariable

100Amostly conserved

119Gmostly conserved

131Gmostly conserved

166Amostly conserved

175Gmostly conserved

181Amostly conserved

196Gmostly conserved

202Cmostly conserved

205Cmostly conserved

206Tmostly conserved

214Gmostly conserved

217Gmostly conserved

229Avariable

232Tmostly conserved

268Amostly conserved

271Cmostly conserved

295Avariable

304Tmostly conserved

313Gmostly conserved

319Tmostly conserved

328Amostly conserved

331Amostly conserved

334Tmostly conserved

340Cmostly conserved

343Tmostly conserved

346Cmostly conserved

361Tvariable

370Gmostly conserved

385Cmostly conserved

386Cmostly conserved

388Amostly conserved

400Cmostly conserved

403Amostly conserved

407Tmostly conserved

409Amostly conserved

412Tmostly conserved

415Amostly conserved

433Gmostly conserved

454Tmostly conserved

466Amostly conserved

469Gmostly conserved

475Amostly conserved

485Tmostly conserved

523Cmostly conserved

526Tmostly conserved

544Gmostly conserved

548Tmostly conserved

550Gmostly conserved

553Cvariable

554Gmostly conserved

559Tmostly conserved

565Gmostly conserved

568Amostly conserved

598Tmostly conserved

601Cmostly conserved

604Cmostly conserved

616Cmostly conserved

619Cmostly conserved

622Amostly conserved

628Amostly conserved

631Amostly conserved

643Tmostly conserved

AACATTATACTTTATTTTCGGAATTTGATCTGGAATAGTGGGAACCTCCCTAAGAATTTTAATTCGAATAGAGCTAGGAAACCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes4

BINs3

Most divergent pair2.0%

EuropeOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type305 records

Wild obs. + sensor118

Museum / vouchered187

Range

Area of Occupancy AOO884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 68≤1 km 26≤10 km 16>10 km 1

111 georeferenced · 7 without coordinates

Open the mapobservation + sensor118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 53≤1 km 59≤10 km 31>10 km 9

152 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence187

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	77
Trondheim, NO	14
MZLUlocation not on record	13
Helsinki, FI	12
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	9
Salzburg, AT	5
BioFokuslocation not on record	4
Oulu, FI	4
Muzeum Górnośląskie w Bytomiulocation not on record	4
neflocation not on record	4
ZSMlocation not on record	3
CBDClocation not on record	3
MNHWlocation not on record	3
NCMGlocation not on record	3
Metsähallituslocation not on record	2
Uniwersytet Jagiellońskilocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Uniwersytet Wrocławskilocation not on record	2
Kuopio, FI	1
NTNU-VMlocation not on record	1
Tartu, EE	1
Tilburg, NL	1
Natur-Museum Luzernlocation not on record	1

23 institutions · 171 of 187 vouchered records shown · 16 without an institution code

09Environmental DNA11 detections

Where the DNA of Aizobius sedi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

pihapiiri

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 11.9–14.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)17.7 °C 13.2–19.0

Min temp (night)8.70 °C 8.00–11.5

Precipitation61.3 mm/mo 57.3–131

Air humidity58.8 % 58.1–63.4

Moisture balance-36.6 mm/mo -51.3–21.4

Vapour deficit643 Pa 513–716

Wind speed3.50 m/s 2.10–4.60

Cloud cover35.6 % 34.4–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)